Here we take a snapshot from the current tip of the master branch of pypath, collect all functions from the pypath.inputs module and run them with an empty cache directory. Basic metrics about the returned values and errors are presented. This simple and automatized procedure is able to reveal the most common errors: if a server is down, if the URL, format or access restrictions changed, or pypath got broken in the recent developments. Note: this report is only about pypath, not about the data in the OmniPath web service; before we build the OmniPath database, we aim to fix the errors which could have an impact on its content.
Compiled between 2021-09-10 16:12:51 and 2021-09-10 18:56:25; pypath version: 0.12.0 (from git; 798688c )
| Modules tested: | 142 |
|---|---|
| Functions tested: | 453 |
| Functions run without error: | 265 |
| Functions skipped due to lack of arguments: | 113 |
| Functions run with error: | 75 |
| Function | Started | Finished | Elapsed (s) | Result type | Result repr | Result size | Error |
|---|---|---|---|---|---|---|---|
| pypath.inputs.abs.abs_interactions | 2021-09-10 16:12:53 | 2021-09-10 16:12:54 | 1.0 | list | [['SRF', 'extracted04'], ['SRF', 'extracted04'], ['SRF', 'extracted04'], ['TEF1', 'extracted04'], ['SP1', 'extracted04'], ['TBP', 'extracted04'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['TEF1', 'X67686'], ['SP1', 'X67686'], ['TBP', 'X67686'], ['SRF', 'extracted05'], ['SRF', 'extrac...(truncated) | 650 | |
| pypath.inputs.acsn.acsn_interactions | 2021-09-10 16:12:54 | 2021-09-10 16:12:54 | 0.0 | list | [AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CA', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454;15509806;16288288;17646672;18644865;20673124'), AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CB', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454...(truncated) | 37,725 | |
| pypath.inputs.acsn.acsn_interactions_sif | 2021-09-10 16:12:54 | 2021-09-10 16:12:55 | 1.0 | list | [['ACHE', 'UNKNOWN_CATALYSIS', 'Cytochrome'], ['ACHE', 'UNKNOWN_CATALYSIS', 'APAF1'], ['E2F1', 'null', 'MIR17-3P'], ['E2F1', 'null', 'p14ARF'], ['E2F1', 'null', 'BAF250'], ['E2F1', 'null', 'HDAC1'], ['E2F1', 'null', 'HP1gamma'], ['E2F1', 'null', 'RB1'], ['E2F1', 'null', 'SUV39H1'], ['E2F1', 'null', ...(truncated) | 9,570 | |
| pypath.inputs.adhesome.adhesome_annotations | 2021-09-10 16:12:56 | 2021-09-10 16:14:05 | 69.0 | defaultdict | defaultdict(<class 'set'>, {'P12814': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'P23528': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q9BR76': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q14247': {AdhesomeAnnotation(mainclas...(truncated) | 239 | |
| pypath.inputs.adhesome.adhesome_interactions | 2021-09-10 16:14:05 | 2021-09-10 16:14:05 | 0.0 | list | [AdhesomeInteraction(source='LPXN', target='GIT1', effect='0', type='Binding', pmid='12674328'), AdhesomeInteraction(source='GIT1', target='ARF1', effect='_', type='Inhibition', pmid='10896954'), AdhesomeInteraction(source='ARPC2', target='CTTN', effect='0', type='Binding', pmid='11018051'), Adhesom...(truncated) | 6,542 | |
| pypath.inputs.almen2009.almen2009_annotations | 2021-09-10 16:14:05 | 2021-09-10 16:14:08 | 3.0 | defaultdict | defaultdict(<class 'set'>, {'P04839': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transmembrane=5, sosui_transmembrane=5, tmhmm_transmembrane=4)}, 'Q9Y5S8': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transme...(truncated) | 4,828 | |
| pypath.inputs.baccin2019.baccin2019_annotations | 2021-09-10 16:14:08 | 2021-09-10 16:20:30 | 382.0 | dict | {} | 0 | |
| pypath.inputs.baccin2019.baccin2019_interactions | 2021-09-10 16:20:30 | 2021-09-10 16:20:44 | 14.0 | list | [] | 0 | |
| pypath.inputs.biogps.biogps_annotations | 2021-09-10 16:20:44 | 2021-09-10 16:43:29 | 1,365.0 | defaultdict | defaultdict(<class 'set'>, {'Q08345': {BiogpsAnnotation(dataset='human_gene_atlas', sample='Lymphoma_burkitts_Daudi', probe='207169_x_at', expression=14.8), BiogpsAnnotation(dataset='human_nci60', sample='U87', probe='210749_x_at', expression=240.557), BiogpsAnnotation(dataset='human_primary_tumors'...(truncated) | 13,237 | |
| pypath.inputs.biogps.biogps_datasets | 2021-09-10 16:43:40 | 2021-09-10 16:43:40 | 0.0 | list | [BiogpsDataset(organism='human', label='human_gene_atlas_ave', url='http://plugins.biogps.org/download/gnf1h-gcrma.zip'), BiogpsDataset(organism='human', label='human_gene_atlas', url='http://plugins.biogps.org/download/gnf1h-gcrma-unaveraged.zip'), BiogpsDataset(organism='human', label='human_nci60...(truncated) | 9 | |
| pypath.inputs.biogps.biogps_download |
Not calling `pypath.inputs.biogps.biogps_download`, not enough arguments. |
||||||
| pypath.inputs.biogps.biogps_download_all | 2021-09-10 16:43:40 | 2021-09-10 16:44:10 | 30.0 | dict | {'human_gene_atlas_ave': probe B_lymphoblasts ... retina small_intestine 0 1007_s_at 137.00 ... 880.675 168.15 1 1053_at 81.75 ... 9.900 8.50 2 117_at 12.55 ...(truncated) | 9 | |
| pypath.inputs.biogrid.biogrid_interactions | 2021-09-10 16:44:11 | 2021-09-10 16:44:17 | 6.0 | list | [BiogridInteraction(partner_a='APOB', partner_b='MTTP', pmid='9915855'), BiogridInteraction(partner_a='CAPN3', partner_b='TTN', pmid='9642272'), BiogridInteraction(partner_a='CDKN3', partner_b='CDK2', pmid='12745075'), BiogridInteraction(partner_a='PPARGC1B', partner_b='ESR1', pmid='11854298'), Biog...(truncated) | 6,355 | |
| pypath.inputs.biomart.biomart_homology | 2021-09-10 16:44:17 | 2021-09-10 16:44:42 | 25.0 | list | [EnsemblRecord(ensembl_gene_id='ENSG00000198888', ensembl_transcript_id='ENST00000361390', ensembl_peptide_id='ENSP00000354687', mmusculus_homolog_ensembl_peptide='ENSMUSP00000080991', mmusculus_homolog_ensembl_gene='ENSMUSG00000064341', mmusculus_homolog_orthology_type='ortholog_one2one', mmusculus...(truncated) | 168,975 | |
| pypath.inputs.biomart.biomart_microarray |
Not calling `pypath.inputs.biomart.biomart_microarray`, not enough arguments. |
||||||
| pypath.inputs.biomart.biomart_microarray_types | 2021-09-10 16:44:42 | 2021-09-10 16:44:42 | 0.0 | list | [{'vendor': 'PHALANX', 'format': 'EXPRESSION', 'description': None, 'type': 'OLIGO', 'array': 'OneArray', 'label': 'PHALANX OneArray'}, {'type': 'OLIGO', 'array': 'CODELINK', 'format': 'EXPRESSION', 'description': None, 'vendor': 'CODELINK', 'label': 'CODELINK CODELINK'}, {'vendor': 'ILLUMINA', 'for...(truncated) | 37 | |
| pypath.inputs.biomart.biomart_microarrays | 2021-09-10 16:44:42 | 2021-09-10 17:21:30 | 2,208.0 | dict | {'ENSG00000198712': {Probe(array='agilent_gpl26966', probe='HMNXSV003032141'), Probe(array='affy_hugene_1_0_st_v1', probe='8043375'), Probe(array='affy_huex_1_0_st_v2', probe='2868799'), Probe(array='affy_huex_1_0_st_v2', probe='4037634'), Probe(array='affy_huex_1_0_st_v2', probe='4037641'), Probe(a...(truncated) | 64,002 | |
| pypath.inputs.biomart.biomart_query |
Not calling `pypath.inputs.biomart.biomart_query`, not enough arguments. |
||||||
| pypath.inputs.ca1.ca1_interactions | 2021-09-10 17:21:31 | 2021-09-10 17:21:32 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/ca1.py", line 58, in ca1_interactions
for l in data['S1.txt'].split('\n')[1:]:
TypeError: 'NoneType' object is not subscriptable
|
|||
| pypath.inputs.cancercellmap.ccmap_interactions | 2021-09-10 17:21:32 | 2021-09-10 17:21:32 | 0.0 | list | [CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q96S28', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q86YA7', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q4T...(truncated) | 47,644 | |
| pypath.inputs.cancerdrugs_db.cancerdrugs_db_annotations | 2021-09-10 17:21:32 | 2021-09-10 17:21:46 | 14.0 | defaultdict | defaultdict(<class 'set'>, {'46220502': {CancerDrugsAnnotation(label='Abemaciclib', indications='Advanced Breast Cancer; Metastatic Breast Cancer', last_updated='17/09/2020')}, '132971': {CancerDrugsAnnotation(label='Abiraterone', indications='Metastatic Castration Resistant Prostate Cancer', last_u...(truncated) | 197 | |
| pypath.inputs.cancerdrugs_db.cancerdrugs_db_download | 2021-09-10 17:21:46 | 2021-09-10 17:21:46 | 0.0 | list | [{'Product': 'Abemaciclib', 'EMA': 'Y', 'FDA': 'Y', 'EN': 'N', 'Other': '', 'WHO': 'N', 'Year': '2017', 'DrugBank ID': '<a href="https://go.drugbank.com/drugs/DB12001">DB12001</a>', 'ATC': 'L01EF03', 'ChEMBL': '<a href="https://www.ebi.ac.uk/chembl/compound_report_card/CHEMBL3301610">CHEMBL3301610</...(truncated) | 281 | |
| pypath.inputs.cancerdrugs_db.cancerdrugs_db_interactions | 2021-09-10 17:21:46 | 2021-09-10 17:21:47 | 1.0 | list | [CancerDrugsInteraction(source={'46220502'}, target={'Q00534'}), CancerDrugsInteraction(source={'46220502'}, target={'P11802'}), CancerDrugsInteraction(source={'46220502'}, target={'P30281'}), CancerDrugsInteraction(source={'46220502'}, target={'Q8N726', 'P42771'}), CancerDrugsInteraction(source={'4...(truncated) | 2,040 | |
| pypath.inputs.cancersea.cancersea_annotations | 2021-09-10 17:21:47 | 2021-09-10 17:21:48 | 1.0 | dict | {'P37023': {CancerseaAnnotation(state='Angiogenesis')}, 'P78504': {CancerseaAnnotation(state='Inflammation'), CancerseaAnnotation(state='Metastasis'), CancerseaAnnotation(state='Angiogenesis')}, 'Q15389': {CancerseaAnnotation(state='Angiogenesis')}, 'O15123': {CancerseaAnnotation(state='Angiogenesis...(truncated) | 1,246 | |
| pypath.inputs.cell.cell_supplementary |
Not calling `pypath.inputs.cell.cell_supplementary`, not enough arguments. |
||||||
| pypath.inputs.cellcall.cellcall_annotations | 2021-09-10 17:21:48 | 2021-09-10 17:21:50 | 2.0 | dict | {'Q9NYJ7': {CellcallAnnotation(role='ligand')}, 'P46531': {CellcallAnnotation(role='receptor')}, 'Q7Z5Y6': {CellcallAnnotation(role='ligand')}, 'Q13873': {CellcallAnnotation(role='receptor')}, 'P09341': {CellcallAnnotation(role='ligand')}, 'P25025': {CellcallAnnotation(role='receptor')}, 'Q6KF10': {...(truncated) | 460 | |
| pypath.inputs.cellcall.cellcall_download | 2021-09-10 17:21:50 | 2021-09-10 17:21:50 | 0.0 | list | [{'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '2626', 'Pathway': 'hsa04530_3,hsa04530_5', 'pathway_ID': 'hsa04530', 'Ligand_Symbol': 'OCLN', 'Receptor_Symbol': 'OCLN', 'TF_Symbol': 'GATA4'}, {'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '8531', 'Pathway': 'hsa045...(truncated) | 19,144 | |
| pypath.inputs.cellcall.cellcall_download_all | 2021-09-10 17:21:50 | 2021-09-10 17:21:51 | 1.0 | list | [{'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '16150', 'Pathway': 'hsa04062_5', 'pathway_ID': 'hsa04062', 'Ligand_Symbol': 'Cxcl13', 'Receptor_Symbol': 'Xcr1', 'TF_Symbol': 'Ikbkb', 'extended': True, 'organism': 10090}, {'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '18033', 'Pat...(truncated) | 38,645 | |
| pypath.inputs.cellcall.cellcall_interactions | 2021-09-10 17:21:51 | 2021-09-10 17:21:53 | 2.0 | list | [CellcallInteraction(ligand_uniprot='Q9NYJ7', receptor_uniprot='P46531', core=True), CellcallInteraction(ligand_uniprot='Q7Z5Y6', receptor_uniprot='Q13873', core=True), CellcallInteraction(ligand_uniprot='P09341', receptor_uniprot='P25025', core=True), CellcallInteraction(ligand_uniprot='Q6KF10', re...(truncated) | 797 | |
| pypath.inputs.cellcellinteractions.cellcellinteractions_annotations | 2021-09-10 17:21:53 | 2021-09-10 17:21:53 | 0.0 | dict | {'Q8IVN8': {CellcellinteractionsAnnotation(mainclass='ECM'), CellcellinteractionsAnnotation(mainclass='Receptor'), CellcellinteractionsAnnotation(mainclass='Ligand')}, 'O95967': {CellcellinteractionsAnnotation(mainclass='ECM'), CellcellinteractionsAnnotation(mainclass='Receptor'), Cellcellinteractio...(truncated) | 3,427 | |
| pypath.inputs.cellchatdb._cellchatdb_organism | 2021-09-10 17:21:54 | 2021-09-10 17:21:54 | 0.0 | int | 9606 | None | |
| pypath.inputs.cellchatdb._cellchatdb_process_cofactors |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_cofactors`, not enough arguments. |
||||||
| pypath.inputs.cellchatdb._cellchatdb_process_complexes |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_complexes`, not enough arguments. |
||||||
| pypath.inputs.cellchatdb.cellchatdb_annotations | 2021-09-10 17:21:54 | 2021-09-10 17:22:00 | 6.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 325, in cellchatdb_annotations
interactions = cellchatdb_interactions(organism = organism)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 227, in cellchatdb_interactions
raw = cellchatdb_download(organism = organism)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 68, in cellchatdb_download
df_names = _rdata_list_get_names(rdata_parsed.object.value[0])
NameError: name '_rdata_list_get_names' is not defined
|
|||
| pypath.inputs.cellchatdb.cellchatdb_cofactors | 2021-09-10 17:22:00 | 2021-09-10 17:22:05 | 5.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 142, in cellchatdb_cofactors
raw = cellchatdb_download(organism = organism)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 68, in cellchatdb_download
df_names = _rdata_list_get_names(rdata_parsed.object.value[0])
NameError: name '_rdata_list_get_names' is not defined
|
|||
| pypath.inputs.cellchatdb.cellchatdb_complexes | 2021-09-10 17:22:05 | 2021-09-10 17:22:10 | 5.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 96, in cellchatdb_complexes
raw = cellchatdb_download(organism = organism)['complex']
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 68, in cellchatdb_download
df_names = _rdata_list_get_names(rdata_parsed.object.value[0])
NameError: name '_rdata_list_get_names' is not defined
|
|||
| pypath.inputs.cellchatdb.cellchatdb_download | 2021-09-10 17:22:10 | 2021-09-10 17:22:16 | 6.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 68, in cellchatdb_download
df_names = _rdata_list_get_names(rdata_parsed.object.value[0])
NameError: name '_rdata_list_get_names' is not defined
|
|||
| pypath.inputs.cellchatdb.cellchatdb_interactions | 2021-09-10 17:22:16 | 2021-09-10 17:22:21 | 5.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 227, in cellchatdb_interactions
raw = cellchatdb_download(organism = organism)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/cellchatdb.py", line 68, in cellchatdb_download
df_names = _rdata_list_get_names(rdata_parsed.object.value[0])
NameError: name '_rdata_list_get_names' is not defined
|
|||
| pypath.inputs.cellphonedb._cellphonedb_annotations |
Not calling `pypath.inputs.cellphonedb._cellphonedb_annotations`, not enough arguments. |
||||||
| pypath.inputs.cellphonedb._cellphonedb_get_entity |
Not calling `pypath.inputs.cellphonedb._cellphonedb_get_entity`, not enough arguments. |
||||||
| pypath.inputs.cellphonedb._cellphonedb_hla |
Not calling `pypath.inputs.cellphonedb._cellphonedb_hla`, not enough arguments. |
||||||
| pypath.inputs.cellphonedb.cellphonedb_complex_annotations | 2021-09-10 17:22:21 | 2021-09-10 17:22:21 | 0.0 | dict | {Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('receptor',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('...(truncated) | 112 | |
| pypath.inputs.cellphonedb.cellphonedb_complexes | 2021-09-10 17:22:21 | 2021-09-10 17:22:21 | 0.0 | dict | {'COMPLEX:P37023_Q13873': Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873, 'COMPLEX:Q04771_Q13873': Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873, 'COMPLEX:P27037_Q04771': Complex ACVR_1A2A receptor: COMPLEX:P27037_Q04771, 'COMPLEX:Q04771_Q13705': Complex ACVR_1A2B receptor: COMPLEX:Q04771_Q13705, 'COMPLEX:...(truncated) | 112 | |
| pypath.inputs.cellphonedb.cellphonedb_interactions | 2021-09-10 17:22:21 | 2021-09-10 17:22:21 | 0.0 | generator | <generator object cellphonedb_interactions at 0x7fda97782dd0> | None | |
| pypath.inputs.cellphonedb.cellphonedb_ligands_receptors | 2021-09-10 17:22:21 | 2021-09-10 17:22:21 | 0.0 | tuple | ({'Q6UWQ7', 'P49763', 'P07492', 'P15813', 'Q15389', 'Q8N126', 'Q8NEV9', 'Q02413', 'Q92896', Complex a4b1 complex: COMPLEX:P05556_P13612, 'Q96A83', 'P08620', 'P61278', 'P14735', 'P01308', 'P08476', 'Q9Y275', Complex a4b7 complex: COMPLEX:P13612_P26010, 'Q13591', 'Q9GZP0', 'P20908', 'P81277', Complex ...(truncated) | 2 | |
| pypath.inputs.cellphonedb.cellphonedb_protein_annotations | 2021-09-10 17:22:21 | 2021-09-10 17:22:21 | 0.0 | dict | {'A4D1S0': CellPhoneDBAnnotation(receptor=True, receptor_class=('klr',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), 'A6NMZ7': CellPhoneDBAnnotation(receptor=False, receptor_class=(), peripheral=False, secreted=True, secreted_class=('secreted',), transme...(truncated) | 978 | |
| pypath.inputs.celltalkdb.celltalkdb_annotations | 2021-09-10 17:22:21 | 2021-09-10 17:22:36 | 15.0 | defaultdict | defaultdict(<class 'set'>, {'Q13275': {CellTalkDBAnnotation(role='ligand', pmid='15721238'), CellTalkDBAnnotation(role='ligand', pmid='26156437'), CellTalkDBAnnotation(role='ligand', pmid='9883722')}, 'P51805': {CellTalkDBAnnotation(role='receptor', pmid='15721238'), CellTalkDBAnnotation(role='recep...(truncated) | 1,598 | |
| pypath.inputs.celltalkdb.celltalkdb_download | 2021-09-10 17:22:36 | 2021-09-10 17:22:36 | 0.0 | generator | <generator object celltalkdb_download at 0x7fda97487270> | None | |
| pypath.inputs.celltalkdb.celltalkdb_interactions | 2021-09-10 17:22:36 | 2021-09-10 17:22:36 | 0.0 | list | [CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA3', reference='15721238'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA1', reference='26156437'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='NRP1', reference='9883...(truncated) | 3,398 | |
| pypath.inputs.compleat.compleat_complexes | 2021-09-10 17:22:36 | 2021-09-10 17:22:40 | 4.0 | dict | {'COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0': Complex: COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0, 'COMPLEX:O43681_O75396_P0CG48_P11441_Q7L5D6_Q8NEP3_Q96DZ5_Q9...(truncated) | 9,692 | |
| pypath.inputs.compleat.compleat_raw | 2021-09-10 17:22:40 | 2021-09-10 17:22:40 | 0.0 | list | [{'compleat_id': 'HC4831', 'member_count': '15', 'predicted': 'Predicted', 'functions': 'protein transport', 'functions2': 'protein transport;cellular membrane fusion;Golgi vesicle transport;vesicle-mediated transport;intracellular transport', 'nothing': '', 'sources': 'NetworkBlast', 'name': '', 'm...(truncated) | 9,704 | |
| pypath.inputs.complexportal.complexportal_complexes | 2021-09-10 17:22:40 | 2021-09-10 17:23:21 | 41.0 | dict | {'COMPLEX:P84022_Q13485_Q15796': Complex SMAD2-SMAD3-SMAD4 complex: COMPLEX:P84022_Q13485_Q15796, 'COMPLEX:P16220_P18848': Complex bZIP transcription factor complex, ATF4-CREB1: COMPLEX:P16220_P18848, 'COMPLEX:P18846_P18848': Complex bZIP transcription factor complex, ATF1-ATF4: COMPLEX:P18846_P1884...(truncated) | 1,055 | |
| pypath.inputs.comppi.comppi_interaction_locations | 2021-09-10 17:23:21 | 2021-09-10 17:23:21 | 0.0 | generator | <generator object comppi_interaction_locations at 0x7fda9b38f820> | None | |
| pypath.inputs.comppi.comppi_locations | 2021-09-10 17:23:21 | 2021-09-10 17:24:21 | 60.0 | dict | {'Q8TES7': {ComppiLocation(location='cytosol', score=0.99997984), ComppiLocation(location='membrane', score=0.96), ComppiLocation(location='cytosol', score=0.8), ComppiLocation(location='nucleus', score=0.9099999999999999), ComppiLocation(location='nucleus', score=0.7), ComppiLocation(location='cyto...(truncated) | 18,238 | |
| pypath.inputs.connectomedb.connectomedb_annotations | 2021-09-10 17:24:22 | 2021-09-10 17:24:22 | 0.0 | dict | {'P01023': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'Q07954': {ConnectomedbAnnotation(role='receptor', location='plasma membrane')}, 'Q16613': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'P48039': {ConnectomedbAnnotation(role='receptor', location='plasma membra...(truncated) | 1,428 | |
| pypath.inputs.connectomedb.connectomedb_interactions | 2021-09-10 17:24:22 | 2021-09-10 17:24:22 | 0.0 | list | [ConnectomedbInteraction(ligand='A2M', ligand_location=['secreted'], receptor='LRP1', references=['1702392', '10652313', '12194978']), ConnectomedbInteraction(ligand='AANAT', ligand_location=['secreted'], receptor='MTNR1A', references=['12943195']), ConnectomedbInteraction(ligand='AANAT', ligand_loc...(truncated) | 2,293 | |
| pypath.inputs.corum.corum_complexes | 2021-09-10 17:24:22 | 2021-09-10 17:24:22 | 0.0 | dict | {'COMPLEX:P41182_P56524': Complex BCL6-HDAC4 complex: COMPLEX:P41182_P56524, 'COMPLEX:P41182_Q9UQL6': Complex BCL6-HDAC5 complex: COMPLEX:P41182_Q9UQL6, 'COMPLEX:P41182_Q8WUI4': Complex BCL6-HDAC7 complex: COMPLEX:P41182_Q8WUI4, 'COMPLEX:Q09472_Q92793_Q92831_Q9Y6Q9': Complex Multisubunit ACTR coacti...(truncated) | 2,734 | |
| pypath.inputs.cosmic.cancer_gene_census_annotations | 2021-09-10 17:24:22 | 2021-09-10 17:24:22 | 0.0 | dict | {} | 0 | |
| pypath.inputs.cpad.cpad_annotations | 2021-09-10 17:24:22 | 2021-09-10 17:24:32 | 10.0 | defaultdict | defaultdict(<class 'set'>, {'Q16181': {CpadAnnotation(regulator_type='protein', effect_on_pathway='Upregulation', pathway='Actin cytoskeleton pathway', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='inhibit glioma cell migration', cancer='Glioma', pathway_category='Regulation of actin cyto...(truncated) | 1,037 | |
| pypath.inputs.cpad.cpad_pathway_cancer | 2021-09-10 17:24:32 | 2021-09-10 17:24:32 | 0.0 | tuple | (defaultdict(<class 'set'>, {'Glioma': {CpadPathwayCancer(pathway='c-Src/FAK associated signaling pathway', cancer='Glioma', pathway_category='Focal adhesion', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='inhibit glioma cell proliferation and invasion'), CpadPathwayCancer(pathway='Notch ...(truncated) | 2 | |
| pypath.inputs.cpad.get_cpad | 2021-09-10 17:24:32 | 2021-09-10 17:24:32 | 0.0 | DictReader | <csv.DictReader object at 0x7fda97816700> | None | |
| pypath.inputs.cpdb.cpdb_interactions | 2021-09-10 17:24:32 | 2021-09-10 17:24:35 | 3.0 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 531,371 | |
| pypath.inputs.cpdb.cpdb_interactions_ltp | 2021-09-10 17:24:36 | 2021-09-10 17:24:38 | 2.0 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 482,222 | |
| pypath.inputs.csa.get_csa | 2021-09-10 17:24:38 | 2021-09-10 17:24:40 | 2.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/csa.py", line 40, in get_csa
u_pdb, pdb_u = get_pdb_chains()
NameError: name 'get_pdb_chains' is not defined
|
|||
| pypath.inputs.cspa.cspa_annotations | 2021-09-10 17:24:40 | 2021-09-10 17:24:41 | 1.0 | dict | {'P08473': {CspaAnnotation(high_confidence=True, n_cell_types=29, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q92854': {CspaAnnotation(high_confidence=True, n_cell_types=26, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q93033': {CspaAnnotation(high_confidence=True, n_cell_types=6, tm=1, gpi=0, uniprot_...(truncated) | 1,446 | |
| pypath.inputs.cspa.cspa_cell_type_annotations | 2021-09-10 17:24:41 | 2021-09-10 17:24:44 | 3.0 | dict | {'A1A5B4': {CspaCellType(cell_type='ZL55', value=18.74705), CspaCellType(cell_type='A431', value=16.56885), CspaCellType(cell_type='HBL1', value=17.03274), CspaCellType(cell_type='SUDHL6', value=16.57829), CspaCellType(cell_type='MedB1', value=17.42748), CspaCellType(cell_type='CD4pCD25n_Tcells', va...(truncated) | 1,407 | |
| pypath.inputs.cspa.cspa_cell_types | 2021-09-10 17:24:44 | 2021-09-10 17:24:46 | 2.0 | defaultdict | defaultdict(<function cspa_cell_types.<locals>.<lambda> at 0x7fdaa7430c10>, {'A431': defaultdict(<class 'dict'>, {'A1A5B4': 16.56885, 'A1A5C7': None, 'A0A0B4J2A2': None, 'P0DN37': None, 'A2RU67': None, 'A2VDJ0': None, 'A6NGN9': None, 'A6NI73': None, 'A6NKL6': None, 'A6NMZ7': 16.08666, 'A7MBM2': 15.1...(truncated) | 47 | |
| pypath.inputs.dbptm.dbptm_enzyme_substrate | 2021-09-10 17:24:46 | 2021-09-10 17:24:49 | 3.0 | list | [{'substrate': 'P30443', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end': 116, 'instance': 'TLRGYYNQSEDGS', 'typ': 'n-linked glycosylation', 'source': 'Swiss-Prot', 'references': ['19159218']}, {'substrate': 'P01892', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end':...(truncated) | 223,135 | |
| pypath.inputs.dbptm.dbptm_enzyme_substrate_old | 2021-09-10 17:24:50 | 2021-09-10 17:24:53 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/dbptm.py", line 96, in dbptm_enzyme_substrate_old
for k, data in iteritems(extra):
NameError: name 'iteritems' is not defined
|
|||
| pypath.inputs.dbptm.dbptm_interactions | 2021-09-10 17:24:53 | 2021-09-10 17:24:54 | 1.0 | list | [['PKA', 'P63104', '11956222;12865427;15883165;16376338'], ['PKB', 'P63104', '11956222;12865427;15883165;16376338'], ['MAPK8', 'P63104', '15071501;15696159'], ['CDK1', 'P11171', '2171679;15525677;18220336;18669648'], ['MAPK1', 'Q13541', '12747827;17081983;17287340;18187866;18669648'], ['CK2', 'P0506...(truncated) | 2,071 | |
| pypath.inputs.deathdomain.deathdomain_interactions | 2021-09-10 17:24:54 | 2021-09-10 17:24:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/deathdomain.py", line 69, in deathdomain_interactions
for p1, v1 in iteritems(d):
NameError: name 'iteritems' is not defined
|
|||
| pypath.inputs.deathdomain.deathdomain_interactions_rescued | 2021-09-10 17:24:54 | 2021-09-10 17:24:55 | 1.0 | list | [['Apaf1', 'Caspase9', 'GST fusion protein pull-down;In vitro purification protein assembly(Size-exclusion chromatography);Yeast two-hybrid;Co-immunoprecipitation;Size-exclusion chromatography;Structure;Gel filtration;β-galactosidase staining;DAPI staining;Caspase cleaved assay', '9390557;9922454;11...(truncated) | 184 | |
| pypath.inputs.depod.depod_enzyme_substrate | 2021-09-10 17:24:55 | 2021-09-10 17:24:55 | 0.0 | list | [] | 0 | |
| pypath.inputs.depod.depod_interactions | 2021-09-10 17:24:55 | 2021-09-10 17:24:55 | 0.0 | list | [('P15309', 'P04626', '11067847|9705354', '2', 'dephosphorylation reaction'), ('Q9BZG2', 'Q15303', '15219672', '1', 'dephosphorylation reaction'), ('P05186', 'P0C0S8', '6167574', '1', 'dephosphorylation reaction'), ('P05186', 'Q92934', 'PMC3005908', '1', 'dephosphorylation reaction'), ('P49593', 'Q1...(truncated) | 832 | |
| pypath.inputs.dgidb.dgidb_annotations | 2021-09-10 17:24:55 | 2021-09-10 17:24:58 | 3.0 | defaultdict | defaultdict(<class 'set'>, {'Q9BXS1': {DgidbAnnotation(category='ENZYME')}, 'Q9BZH6': {DgidbAnnotation(category='TRANSCRIPTION FACTOR')}, 'Q96Q89': {DgidbAnnotation(category='ENZYME')}, 'Q99470': {DgidbAnnotation(category='DRUGGABLE GENOME')}, 'Q9H211': {DgidbAnnotation(category='KINASE')}, 'O95069'...(truncated) | 10,494 | |
| pypath.inputs.dgidb.get_dgidb_old | 2021-09-10 17:24:58 | 2021-09-10 17:24:59 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/dgidb.py", line 77, in get_dgidb_old
soup = bs4.BeautifulSoup(html, 'html.parser')
NameError: name 'bs4' is not defined
|
|||
| pypath.inputs.dip.dip_interactions | 2021-09-10 17:24:59 | 2021-09-10 17:25:01 | 2.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/dip.py", line 55, in dip_interactions
specA = int(l[9].split(':')[1].split('(')[0])
IndexError: list index out of range
|
|||
| pypath.inputs.dip.dip_login |
Not calling `pypath.inputs.dip.dip_login`, not enough arguments. |
||||||
| pypath.inputs.disgenet.disgenet_annotations | 2021-09-10 17:25:01 | 2021-09-10 17:25:05 | 4.0 | defaultdict | defaultdict(<class 'set'>, {'P04217': {DisGeNetAnnotation(disease='Hepatomegaly', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',)), DisGeNetAnnotation(disease='Schizophrenia', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',))}, 'P01023': {Di...(truncated) | 9,202 | |
| pypath.inputs.domino.domino_ddi | 2021-09-10 17:25:05 | 2021-09-10 17:36:40 | 695.0 | list | [<pypath.internals.intera.DomainDomain object at 0x7fdaa671fe50>, <pypath.internals.intera.DomainDomain object at 0x7fdac4305190>, <pypath.internals.intera.DomainDomain object at 0x7fda9b8962e0>, <pypath.internals.intera.DomainDomain object at 0x7fda9b8966d0>, <pypath.internals.intera.DomainDomain o...(truncated) | 1,294 | |
| pypath.inputs.domino.domino_enzsub | 2021-09-10 17:36:40 | 2021-09-10 17:47:50 | 670.0 | dict | {'ddi': [<pypath.internals.intera.DomainDomain object at 0x7fdaee546f40>, <pypath.internals.intera.DomainDomain object at 0x7fdaee546880>, <pypath.internals.intera.DomainDomain object at 0x7fda9c0bffa0>, <pypath.internals.intera.DomainDomain object at 0x7fda9c087eb0>, <pypath.internals.intera.Domain...(truncated) | 2 | |
| pypath.inputs.domino.domino_interactions | 2021-09-10 17:47:50 | 2021-09-10 17:47:51 | 1.0 | list | [DominoRecord(uniprot_A='A4GZ26', uniprot_B='Q8BKX1', isoform_A='1', isoform_B='1', exp_method='two hybrid', references='10.1016/j.brainres.2008.11.061', taxon_A='10090', taxon_B='10090', role_A='physical association', role_B='unspecified role', binding_site_range_A='1424-1434', binding_site_range_B...(truncated) | 6,687 | |
| pypath.inputs.domino.get_domino | 2021-09-10 17:47:51 | 2021-09-10 17:47:51 | 0.0 | list | [DominoRecord(uniprot_A='O00459', uniprot_B='', isoform_A='1', isoform_B='', exp_method='', references='', taxon_A='9606', taxon_B='', role_A='mint', role_B='neutral component', binding_site_range_A='4-80', binding_site_range_B='', domains_A='', domains_B='', ptm_residue_A='', ptm_residue_B='', ptm_...(truncated) | 14,539 | |
| pypath.inputs.dorothea._process_resources |
Not calling `pypath.inputs.dorothea._process_resources`, not enough arguments. |
||||||
| pypath.inputs.dorothea.dorothea_interactions | 2021-09-10 17:47:51 | 2021-09-10 17:47:51 | 0.0 | generator | <generator object dorothea_interactions at 0x7fdaa75bb5f0> | None | |
| pypath.inputs.dorothea.dorothea_old_csv | 2021-09-10 17:47:51 | 2021-09-10 17:47:51 | 0.0 | generator | <generator object dorothea_old_csv at 0x7fdaa75bb5f0> | None | |
| pypath.inputs.dorothea.dorothea_old_csv | 2021-09-10 17:47:51 | 2021-09-10 17:47:51 | 0.0 | generator | <generator object dorothea_old_csv at 0x7fdaa75bb5f0> | None | |
| pypath.inputs.dorothea.dorothea_rda_raw | 2021-09-10 17:47:51 | 2021-09-10 17:47:59 | 8.0 | DataFrame | tf target mor ... which_inferred which_tfbs pubmed_id 0 ADNP AASDH 0.0 ... gtex none - 1 ADNP AASDHPPT 0.0 ... gtex none - 2 ADNP ABCB10 0.0 ... gtex none - 3 ADN...(truncated) | 1,019,220 | |
| pypath.inputs.dorothea.get_dorothea_old | 2021-09-10 17:47:59 | 2021-09-10 17:48:00 | 1.0 | generator | <generator object get_dorothea_old.<locals>.<genexpr> at 0x7fda9b90f350> | None | |
| pypath.inputs.dorothea.dorothea_rda_raw | 2021-09-10 17:48:00 | 2021-09-10 17:48:07 | 7.0 | DataFrame | tf target mor ... which_inferred which_tfbs pubmed_id 0 ADNP AASDH 0.0 ... gtex none - 1 ADNP AASDHPPT 0.0 ... gtex none - 2 ADNP ABCB10 0.0 ... gtex none - 3 ADN...(truncated) | 1,019,220 | |
| pypath.inputs.dorothea.dorothea_interactions | 2021-09-10 17:48:07 | 2021-09-10 17:48:07 | 0.0 | generator | <generator object dorothea_interactions at 0x7fdacfcefcf0> | None | |
| pypath.inputs.dorothea.dorothea_old_csv | 2021-09-10 17:48:07 | 2021-09-10 17:48:07 | 0.0 | generator | <generator object dorothea_old_csv at 0x7fdacfcefcf0> | None | |
| pypath.inputs.ebi.ebi_rest |
Not calling `pypath.inputs.ebi.ebi_rest`, not enough arguments. |
||||||
| pypath.inputs.elm.elm_classes | 2021-09-10 17:48:07 | 2021-09-10 17:48:07 | 0.0 | dict | {'CLV_C14_Caspase3-7': ELMClass(accession='ELME000321', identifier='CLV_C14_Caspase3-7', functional_name='Caspase cleavage motif', description='Caspase-3 and Caspase-7 cleavage site.', regex='[DSTE][^P][^DEWHFYC]D[GSAN]', probability='0.00309374033071', n_instances='41', n_pdb='0'), 'CLV_MEL_PAP_1':...(truncated) | 317 | |
| pypath.inputs.elm.elm_domains | 2021-09-10 17:48:07 | 2021-09-10 17:48:08 | 1.0 | dict | {'FZR_HUMAN': {'LIG_APCC_Dbox_1': [('218', '471')]}, 'BIRC3_HUMAN': {'LIG_BIR_II_1': [('172', '236')]}} | 2 | |
| pypath.inputs.elm.elm_instances | 2021-09-10 17:48:08 | 2021-09-10 17:48:08 | 0.0 | list | [ELMInstance(accession='ELMI003774', type='CLV', identifier='CLV_C14_Caspase3-7', uniprot_id='A0A0H3NIK3_SALTS', uniprot='A0A0H3NIK3', synonyms='A0A0H3NIK3', start='483', end='487', references='20947770', methods='enzymatic reaction; mutation analysis; protease assay; western blot', logic='true posi...(truncated) | 3,934 | |
| pypath.inputs.elm.elm_interactions | 2021-09-10 17:48:08 | 2021-09-10 17:48:08 | 0.0 | list | [ELMInteraction(motif_elm='CLV_Separin_Fungi', domain_pfam='PF03568', uniprot_motif='Q12158', uniprot_domain='Q03018', isoform_motif=1, isoform_domain=1, start_motif=175, end_motif=181, start_domain=1171, end_domain=1571, affinity_min=None, affinity_max=None, pubmeds=(10403247, 14585836), taxon_moti...(truncated) | 2,394 | |
| pypath.inputs.embrace._embrace_id_translation |
Not calling `pypath.inputs.embrace._embrace_id_translation`, not enough arguments. |
||||||
| pypath.inputs.embrace.embrace_annotations | 2021-09-10 17:48:08 | 2021-09-10 17:48:23 | 15.0 | dict | {'P01023': {EmbraceAnnotation(mainclass='ligand', neuron=True, mural_cell=False, microglia=False, endothelial_cell=False)}, 'Q07954': {EmbraceAnnotation(mainclass='receptor', neuron=True, mural_cell=False, microglia=True, endothelial_cell=False)}, 'P12821': {EmbraceAnnotation(mainclass='ligand', neu...(truncated) | 942 | |
| pypath.inputs.embrace.embrace_interactions | 2021-09-10 17:48:23 | 2021-09-10 17:48:24 | 1.0 | list | [EmbraceInteraction(ligand='P01023', receptor='Q07954'), EmbraceInteraction(ligand='P12821', receptor='P30411'), EmbraceInteraction(ligand='O14672', receptor='P30530'), EmbraceInteraction(ligand='O14672', receptor='P29320'), EmbraceInteraction(ligand='O43184', receptor='Q13797'), EmbraceInteraction(...(truncated) | 1,688 | |
| pypath.inputs.embrace.embrace_raw | 2021-09-10 17:48:24 | 2021-09-10 17:48:24 | 0.0 | list | [EmbraceRawRecord(ligand_symbol='A2m', receptor_symbol='Lrp1', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=0, N_receptor=1, P_receptor=0, M_receptor=1, EC_receptor=0), EmbraceRawRecord(ligand_symbol='Ace', receptor_symbol='Bdkrb2', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=1, N_receptor=0, P_r...(truncated) | 1,710 | |
| pypath.inputs.embrace.embrace_translated | 2021-09-10 17:48:24 | 2021-09-10 17:48:24 | 0.0 | list | [EmbraceRawRecord(ligand_symbol='P01023', receptor_symbol='Q07954', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=0, N_receptor=1, P_receptor=0, M_receptor=1, EC_receptor=0), EmbraceRawRecord(ligand_symbol='P12821', receptor_symbol='P30411', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=1, N_recepto...(truncated) | 1,770 | |
| pypath.inputs.encode.encode_tf_mirna_interactions | 2021-09-10 17:48:24 | 2021-09-10 17:48:25 | 1.0 | list | [EncodeInteraction(tf_genesymbol='BDP1', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='RAD21', mirna='hsa-miR-92a-1*'), EncodeInteraction(tf_genesymbol='ESR1', mirna='hsa-miR-23b*'), EncodeInteraction(tf_genesymbol='BCL3', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='HEY1', ...(truncated) | 1,237 | |
| pypath.inputs.ensembl.ensembl_organisms | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 | list | [EnsemblOrganism(common_name='Abingdon island giant tortoise', scientific_name='Chelonoidis abingdonii', taxon_id=106734, ensembl_assembly='ASM359739v1', accession='GCA_003597395.1', genebuild_method='Full genebuild', variation_database='-', regulation_database='-', ensembl_name='cabingdonii'), Ense...(truncated) | 310 | |
| pypath.inputs.exocarta._get_exocarta_vesiclepedia | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 | generator | <generator object _get_exocarta_vesiclepedia at 0x7fdacb809c10> | None | |
| pypath.inputs.exocarta.get_exocarta | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 | generator | <generator object _get_exocarta_vesiclepedia at 0x7fdacb809cf0> | None | |
| pypath.inputs.exocarta.get_vesiclepedia | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 | generator | <generator object _get_exocarta_vesiclepedia at 0x7fdacb809cf0> | None | |
| pypath.inputs.genecards.genecards_datasheet |
Not calling `pypath.inputs.genecards.genecards_datasheet`, not enough arguments. |
||||||
| pypath.inputs.genecards.genecards_soup |
Not calling `pypath.inputs.genecards.genecards_soup`, not enough arguments. |
||||||
| pypath.inputs.genecards.genecards_summaries |
Not calling `pypath.inputs.genecards.genecards_summaries`, not enough arguments. |
||||||
| pypath.inputs.go.get_go_desc |
Not calling `pypath.inputs.go.get_go_desc`, not enough arguments. |
||||||
| pypath.inputs.go.get_go_quick | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 843, in get_go_quick
_ = next(c.result)
TypeError: 'NoneType' object is not an iterator
|
|||
| pypath.inputs.go.get_goslim | 2021-09-10 17:48:25 | 2021-09-10 17:48:25 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 859, in get_goslim
if isinstance(url, common.basestring) else
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_ancestors_quickgo | 2021-09-10 17:48:25 | 2021-09-10 17:59:27 | 662.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 153, in go_ancestors_quickgo
desc = go_descendants_quickgo(aspects = aspects)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 305, in go_descendants_quickgo
desc[asp] = download_in_chunks(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 238, in download_in_chunks
paginator = common.paginate(terms, chunk_size)
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_ancestors_goose | 2021-09-10 17:59:27 | 2021-09-10 17:59:27 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 120, in go_ancestors_goose
sql_path = os.path.join(common.DATA, 'goose_ancestors.sql')
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_ancestors_quickgo | 2021-09-10 17:59:27 | 2021-09-10 17:59:29 | 2.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 153, in go_ancestors_quickgo
desc = go_descendants_quickgo(aspects = aspects)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 305, in go_descendants_quickgo
desc[asp] = download_in_chunks(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 238, in download_in_chunks
paginator = common.paginate(terms, chunk_size)
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_annotations_goa | 2021-09-10 17:59:29 | 2021-09-10 17:59:32 | 3.0 | dict | {'C': defaultdict(<class 'set'>, {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H8': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H9': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A...(truncated) | 3 | |
| pypath.inputs.go.go_annotations_goa | 2021-09-10 17:59:32 | 2021-09-10 17:59:33 | 1.0 | dict | {'C': defaultdict(<class 'set'>, {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H8': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H9': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A...(truncated) | 3 | |
| pypath.inputs.go.go_annotations_goose | 2021-09-10 17:59:33 | 2021-09-10 17:59:33 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 759, in go_annotations_goose
sql_path = os.path.join(common.DATA, 'goose_annotations.sql')
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_annotations_solr | 2021-09-10 17:59:33 | 2021-09-10 17:59:34 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 664, in go_annotations_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
NameError: name 'etree' is not defined
|
|||
| pypath.inputs.go.go_annotations_uniprot | 2021-09-10 17:59:34 | 2021-09-10 17:59:54 | 20.0 | dict | {'Entry': ['Gene ontology IDs'], 'Q00266': ['GO:0000096', 'GO:0001887', 'GO:0004478', 'GO:0005524', 'GO:0005829', 'GO:0006556', 'GO:0006730', 'GO:0009087', 'GO:0032259', 'GO:0042802', 'GO:0046872', 'GO:0051289'], 'Q8NB16': ['GO:0004672', 'GO:0004706', 'GO:0005524', 'GO:0005634', 'GO:0005737', 'GO:00...(truncated) | 20,387 | |
| pypath.inputs.go.go_descendants_quickgo | 2021-09-10 17:59:54 | 2021-09-10 17:59:57 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 305, in go_descendants_quickgo
desc[asp] = download_in_chunks(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 238, in download_in_chunks
paginator = common.paginate(terms, chunk_size)
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_descendants_goose | 2021-09-10 17:59:57 | 2021-09-10 17:59:57 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 206, in go_descendants_goose
anc = go_ancestors_goose(aspects = aspects)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 120, in go_ancestors_goose
sql_path = os.path.join(common.DATA, 'goose_ancestors.sql')
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_descendants_quickgo | 2021-09-10 17:59:57 | 2021-09-10 18:00:00 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 305, in go_descendants_quickgo
desc[asp] = download_in_chunks(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 238, in download_in_chunks
paginator = common.paginate(terms, chunk_size)
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_descendants_to_ancestors |
Not calling `pypath.inputs.go.go_descendants_to_ancestors`, not enough arguments. |
||||||
| pypath.inputs.go.go_terms_quickgo | 2021-09-10 18:00:00 | 2021-09-10 18:00:03 | 3.0 | dict | {'C': {'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:0030694': 'bacterial-type flagellum basal body, rod', 'GO:0030691': 'Noc2p-Noc3p complex', 'GO:0030690': 'Noc1p-Noc2p complex', 'GO:0015050': 'methane monooxygenase complex', 'GO:0030689': 'Noc com...(truncated) | 3 | |
| pypath.inputs.go.go_terms_goose | 2021-09-10 18:00:03 | 2021-09-10 18:00:03 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 488, in go_terms_goose
sql_path = os.path.join(common.DATA, 'goose_terms.sql')
NameError: name 'common' is not defined
|
|||
| pypath.inputs.go.go_terms_quickgo | 2021-09-10 18:00:03 | 2021-09-10 18:00:05 | 2.0 | dict | {'C': {'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:0030694': 'bacterial-type flagellum basal body, rod', 'GO:0030691': 'Noc2p-Noc3p complex', 'GO:0030690': 'Noc1p-Noc2p complex', 'GO:0015050': 'methane monooxygenase complex', 'GO:0030689': 'Noc com...(truncated) | 3 | |
| pypath.inputs.go.go_terms_solr | 2021-09-10 18:00:05 | 2021-09-10 18:00:06 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/go.py", line 360, in go_terms_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
NameError: name 'etree' is not defined
|
|||
| pypath.inputs.gpcrdb.gpcrdb_annotations | 2021-09-10 18:00:06 | 2021-09-10 18:00:07 | 1.0 | dict | {'P08908': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28222': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28221': {GpcrdbAnnotati...(truncated) | 402 | |
| pypath.inputs.graphviz.graphviz_attrs | 2021-09-10 18:00:07 | 2021-09-10 18:00:07 | 0.0 | tuple | ({'_background': {'type': 'string', 'default': '<none>', 'min': '', 'notes': ''}, 'bb': {'type': 'rect', 'default': '', 'min': '', 'notes': 'write only'}, 'bgcolor': {'type': 'colorcolorList', 'default': '<none>', 'min': '', 'notes': ''}, 'center': {'type': 'bool', 'default': 'false', 'min': '', 'no...(truncated) | 3 | |
| pypath.inputs.guide2pharma.guide2pharma_complexes |
Not calling `pypath.inputs.guide2pharma.guide2pharma_complexes`, not enough arguments. |
||||||
| pypath.inputs.guide2pharma.guide2pharma_download | 2021-09-10 18:00:07 | 2021-09-10 18:00:12 | 5.0 | tuple | ([GuideToPharmacologyInteraction(ligand='TNFSF9', ligand_id_type='genesymbol', target='Q07011', target_id_type='uniprot', target_is_ligand=False, ligand_organism=9606, target_organism=9606, effect=0, ligand_location=None, target_type=None, ligand_endogenous=True, pubmed_ids=[]), GuideToPharmacologyI...(truncated) | 2 | |
| pypath.inputs.guide2pharma.guide2pharma_interactions |
Not calling `pypath.inputs.guide2pharma.guide2pharma_interactions`, not enough arguments. |
||||||
| pypath.inputs.havugimana.get_havugimana | 2021-09-10 18:00:12 | 2021-09-10 18:00:16 | 4.0 | list | [['C_1', '2.0', 'O60547,P30043', 'GMDS_HUMAN,BLVRB_HUMAN', '0.0', 'O60547,P30043,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'Fungi'], ['C_2', '2.0', 'Q92785,Q9NVP1', 'REQU_HUMAN,DDX18_HUMAN', '0.0', 'Q92785,Q9NVP1,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'vertebrates'], ['C_3', '2.0', 'Q...(truncated) | 622 | |
| pypath.inputs.havugimana.havugimana_complexes | 2021-09-10 18:00:16 | 2021-09-10 18:00:16 | 0.0 | dict | {'COMPLEX:O60547_P30043': Complex: COMPLEX:O60547_P30043, 'COMPLEX:Q92785_Q9NVP1': Complex: COMPLEX:Q92785_Q9NVP1, 'COMPLEX:O95249_Q86Y82': Complex: COMPLEX:O95249_Q86Y82, 'COMPLEX:P26583_Q9UPN6': Complex: COMPLEX:P26583_Q9UPN6, 'COMPLEX:P15408_P18846': Complex: COMPLEX:P15408_P18846, 'COMPLEX:P2325...(truncated) | 622 | |
| pypath.inputs.hgnc.hgnc_genegroups | 2021-09-10 18:00:16 | 2021-09-10 18:00:24 | 8.0 | defaultdict | defaultdict(<class 'set'>, {'P04217': {HGNCGeneGroupAnnotation(mainclass='Immunoglobulin like domain containing')}, 'Q9NQ94': {HGNCGeneGroupAnnotation(mainclass='RNA binding motif containing')}, 'P01023': {HGNCGeneGroupAnnotation(mainclass='C3 and PZP like, alpha-2-macroglobulin domain containing')}...(truncated) | 14,898 | |
| pypath.inputs.hippie.hippie_interactions | 2021-09-10 18:00:24 | 2021-09-10 18:00:34 | 10.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hippie.py", line 115, in hippie_interactions
_organisms = {
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hippie.py", line 116, in <setcomp>
taxonomy.ensure_ncbi_tax_id(name)
TypeError: unhashable type: 'set'
|
|||
| pypath.inputs.homologene.get_homologene | 2021-09-10 18:00:34 | 2021-09-10 18:00:34 | 0.0 | generator | <generator object FileOpener.iterfile at 0x7fdacdbff2e0> | None | |
| pypath.inputs.homologene.homologene_dict |
Not calling `pypath.inputs.homologene.homologene_dict`, not enough arguments. |
||||||
| pypath.inputs.homologene.homologene_uniprot_dict |
Not calling `pypath.inputs.homologene.homologene_uniprot_dict`, not enough arguments. |
||||||
| pypath.inputs.hpmr.get_hpmr | 2021-09-10 18:00:34 | 2021-09-10 18:00:37 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 163, in get_hpmr
recname_u = mapping.map_name0(recname, 'genesymbol', 'uniprot')
NameError: name 'mapping' is not defined
|
|||
| pypath.inputs.hpmr.hpmr_annotations | 2021-09-10 18:00:37 | 2021-09-10 18:00:37 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 275, in hpmr_annotations
hpmr_data = get_hpmr(use_cache = use_cache)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 163, in get_hpmr
recname_u = mapping.map_name0(recname, 'genesymbol', 'uniprot')
NameError: name 'mapping' is not defined
|
|||
| pypath.inputs.hpmr.hpmr_complexes | 2021-09-10 18:00:37 | 2021-09-10 18:00:38 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 240, in hpmr_complexes
hpmr_data = get_hpmr(use_cache = use_cache)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 163, in get_hpmr
recname_u = mapping.map_name0(recname, 'genesymbol', 'uniprot')
NameError: name 'mapping' is not defined
|
|||
| pypath.inputs.hpmr.hpmr_interactions | 2021-09-10 18:00:38 | 2021-09-10 18:00:38 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 261, in hpmr_interactions
hpmr_data = get_hpmr(use_cache = use_cache)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/hpmr.py", line 163, in get_hpmr
recname_u = mapping.map_name0(recname, 'genesymbol', 'uniprot')
NameError: name 'mapping' is not defined
|
|||
| pypath.inputs.hprd.get_hprd | 2021-09-10 18:00:38 | 2021-09-10 18:00:43 | 5.0 | list | [['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '128', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '91', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '353', 'K', '-', '-', 'Acetylation', ...(truncated) | 86,981 | |
| pypath.inputs.hprd.hprd_enzyme_substrate | 2021-09-10 18:00:43 | 2021-09-10 18:00:45 | 2.0 | list | [{'resaa': 'Y', 'resnum': 12, 'typ': 'dephosphorylation', 'references': ['16291744'], 'kinase': 'PTPN1', 'substrate_refseqp': 'NP_001093.1', 'substrate': 'ACTN1', 'start': 5, 'end': 19, 'instance': None}, {'resaa': 'Y', 'resnum': 705, 'typ': 'phosphorylation', 'references': ['11940572', '11294897', ...(truncated) | 4,671 | |
| pypath.inputs.hprd.hprd_interactions | 2021-09-10 18:00:45 | 2021-09-10 18:00:46 | 1.0 | list | [['00020', 'ACTN1', '00020_1', 'NP_001093.1', '12', 'Y', 'PTPN1', '01477', 'Dephosphorylation', 'in vitro;in vivo', '16291744'], ['00026', 'STAT3', '00026_1', 'NP_644805.1', '705', 'Y', 'FGFR3', '00624', 'Phosphorylation', 'in vivo', '11940572,11294897,10918587,12244095,11350938,12626508,8626374,125...(truncated) | 4,671 | |
| pypath.inputs.hprd.hprd_interactions_htp | 2021-09-10 18:00:46 | 2021-09-10 18:00:48 | 2.0 | list | [['ALDH1A1', '00001', 'NP_000680.2', 'ALDH1A1', '00001', 'NP_000680.2', 'in vivo;yeast 2-hybrid', '12081471,16189514'], ['ITGA7', '02761', 'NP_001138468.1', 'CHRNA1', '00007', 'NP_001034612.1', 'in vivo', '10910772'], ['PPP1R9A', '16000', 'NP_060120.2', 'ACTG1', '00017', 'NP_001605.1', 'in vitro;in ...(truncated) | 39,241 | |
| pypath.inputs.htri.htri_interactions | 2021-09-10 18:00:48 | 2021-09-10 18:00:52 | 4.0 | list | [HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='196', genesymbol_tf='AHR...(truncated) | 18,630 | |
| pypath.inputs.humancellmap.humancellmap_annotations | 2021-09-10 18:00:52 | 2021-09-10 18:00:53 | 1.0 | dict | {'Q9NRG9': {HumancellmapAnnotation(localization='peroxisome', method='NMF'), HumancellmapAnnotation(localization='nuclear outer membrane-ER membrane network', method='SAFE'), HumancellmapAnnotation(localization='mitochondrial outer membrane', method='NMF')}, 'Q2M2I8': {HumancellmapAnnotation(localiz...(truncated) | 4,371 | |
| pypath.inputs.humap.humap2_complexes | 2021-09-10 18:00:53 | 2021-09-10 18:00:56 | 3.0 | dict | {'COMPLEX:O95900_Q9BQS8': Complex: COMPLEX:O95900_Q9BQS8, 'COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9': Complex: COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9, 'COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6ZRY4_Q93062_Q96S66_Q9NZC3_Q9UF11_Q9Y6M7': Complex: COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6Z...(truncated) | 6,950 | |
| pypath.inputs.humap.humap_complexes | 2021-09-10 18:00:56 | 2021-09-10 18:00:57 | 1.0 | dict | {'COMPLEX:Q7L523_Q8NBW4_Q9HB90': Complex: COMPLEX:Q7L523_Q8NBW4_Q9HB90, 'COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3': Complex: COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3, 'COMPLEX:P31942_Q32P51': Complex: COMPLEX:P31942_Q32P51, 'COMPLEX:P35606_Q9NTJ5_Q9UBF2': Complex: COM...(truncated) | 4,502 | |
| pypath.inputs.huri._huri_interactions |
Not calling `pypath.inputs.huri._huri_interactions`, not enough arguments. |
||||||
| pypath.inputs.huri.hi_i_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.hi_ii_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.hi_iii_old | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object hi_iii_old at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.hi_union_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.huri_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.lit_bm_13_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object lit_bm_13_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.lit_bm_17_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object lit_bm_17_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.lit_bm_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object lit_bm_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.rolland_hi_ii_14 | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object rolland_hi_ii_14 at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.vidal_hi_iii_old |
Not calling `pypath.inputs.huri.vidal_hi_iii_old`, not enough arguments. |
||||||
| pypath.inputs.huri.yang2016_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.huri.yu2011_interactions | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 | generator | <generator object _huri_interactions at 0x7fdaa53633c0> | None | |
| pypath.inputs.i3d.get_i3d | 2021-09-10 18:00:57 | 2021-09-10 18:00:57 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/i3d.py", line 34, in get_i3d
dname_pfam, pfam_dname = pfam_input.pfam_names()
NameError: name 'pfam_input' is not defined
|
|||
| pypath.inputs.icellnet._icellnet_get_components |
Not calling `pypath.inputs.icellnet._icellnet_get_components`, not enough arguments. |
||||||
| pypath.inputs.icellnet._icellnet_get_entity |
Not calling `pypath.inputs.icellnet._icellnet_get_entity`, not enough arguments. |
||||||
| pypath.inputs.icellnet._icellnet_get_references |
Not calling `pypath.inputs.icellnet._icellnet_get_references`, not enough arguments. |
||||||
| pypath.inputs.icellnet._icellnet_get_resources |
Not calling `pypath.inputs.icellnet._icellnet_get_resources`, not enough arguments. |
||||||
| pypath.inputs.icellnet.icellnet_annotations | 2021-09-10 18:00:57 | 2021-09-10 18:00:58 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'P04439': {IcellnetAnnotation(role='ligand', family='Antigen binding', subfamily=None, classification=('Antigen binding',))}, 'Q8NHL6': {IcellnetAnnotation(role='receptor', family='Antigen binding', subfamily=None, classification=('Antigen binding',))}, 'P01889': {Icellne...(truncated) | 517 | |
| pypath.inputs.icellnet.icellnet_complexes | 2021-09-10 18:00:58 | 2021-09-10 18:00:58 | 0.0 | dict | {'COMPLEX:P01857_P0CG04': Complex: COMPLEX:P01857_P0CG04, 'COMPLEX:P36897_P37173': Complex: COMPLEX:P36897_P37173, 'COMPLEX:O95256_Q13478': Complex: COMPLEX:O95256_Q13478, 'COMPLEX:P14778_Q9NPH3': Complex: COMPLEX:P14778_Q9NPH3, 'COMPLEX:P27930_Q9NPH3': Complex: COMPLEX:P27930_Q9NPH3, 'COMPLEX:Q9HB2...(truncated) | 94 | |
| pypath.inputs.icellnet.icellnet_interactions | 2021-09-10 18:00:58 | 2021-09-10 18:00:58 | 0.0 | generator | <generator object icellnet_interactions at 0x7fdaa5363740> | None | |
| pypath.inputs.ielm.get_ielm |
Not calling `pypath.inputs.ielm.get_ielm`, not enough arguments. |
||||||
| pypath.inputs.ielm.get_ielm_huge |
Not calling `pypath.inputs.ielm.get_ielm_huge`, not enough arguments. |
||||||
| pypath.inputs.imweb._get_imweb | 2021-09-10 18:00:58 | 2021-09-10 18:01:03 | 5.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/imweb.py", line 73, in _get_imweb
hdrs.append('Cookie: access-token=%s' % json.loads(c0.result)['token'])
File "/usr/lib/python3.9/json/__init__.py", line 339, in loads
raise TypeError(f'the JSON object must be str, bytes or bytearray, '
TypeError: the JSON object must be str, bytes or bytearray, not NoneType
|
|||
| pypath.inputs.imweb.get_imweb | 2021-09-10 18:01:03 | 2021-09-10 18:01:03 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/imweb.py", line 112, in get_imweb
token = json.loads(fp.read())['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
|||
| pypath.inputs.imweb.get_imweb_req | 2021-09-10 18:01:03 | 2021-09-10 18:01:03 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/imweb.py", line 138, in get_imweb_req
r0 = requests.get(login)
NameError: name 'requests' is not defined
|
|||
| pypath.inputs.innatedb.innatedb_interactions | 2021-09-10 18:01:03 | 2021-09-10 18:01:05 | 2.0 | list | [InnatedbInteraction(source_uniprot='Q9Y6Y9', source_genesymbol='LY96', target_uniprot='O00206', target_genesymbol='TLR4', pmid='10359581'), InnatedbInteraction(source_uniprot='Q99836', source_genesymbol='MYD88', target_uniprot='O00206', target_genesymbol='TLR4', pmid='17228323'), InnatedbInteractio...(truncated) | 19,036 | |
| pypath.inputs.instruct.get_instruct | 2021-09-10 18:01:05 | 2021-09-10 18:01:05 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/instruct.py", line 34, in get_instruct
non_digit = re.compile(r'[^\d.-]+')
NameError: name 're' is not defined
|
|||
| pypath.inputs.instruct.get_instruct_offsets | 2021-09-10 18:01:05 | 2021-09-10 18:01:05 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/instruct.py", line 83, in get_instruct_offsets
non_digit = re.compile(r'[^\d.-]+')
NameError: name 're' is not defined
|
|||
| pypath.inputs.intact._try_isoform |
Not calling `pypath.inputs.intact._try_isoform`, not enough arguments. |
||||||
| pypath.inputs.intact.intact_interactions | 2021-09-10 18:01:05 | 2021-09-10 18:02:17 | 72.0 | list | [IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', id_type_b='uniprot', pubmeds={'10542231'}, methods={'peptide array'}, mi_score='0.77', isoform_a=None, isoform_b=None), IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', id_type_b='uniprot', pubmeds={'10542231'}...(truncated) | 69,929 | |
| pypath.inputs.integrins.get_integrins | 2021-09-10 18:02:18 | 2021-09-10 18:02:18 | 0.0 | set | {'P26012', 'P17301', 'P26006', 'P53708', 'P20701', 'P56199', 'P08648', 'P23229', 'P05556', 'P18564', 'P16144', 'P08514', 'P26010', 'P05107', 'P20702', 'Q13349', 'Q9UKX5', 'P05106', 'P11215', 'P06756', 'O75578', 'Q13683', 'P18084', 'Q13797', 'P38570'} | 25 | |
| pypath.inputs.intogen.intogen_annotations | 2021-09-10 18:02:18 | 2021-09-10 18:02:19 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/intogen.py", line 60, in intogen_annotations
__ = c.result['Drivers_type_role.tsv'].readline()
TypeError: 'NoneType' object is not subscriptable
|
|||
| pypath.inputs.ipi._ipi_uniprot_pairs |
Not calling `pypath.inputs.ipi._ipi_uniprot_pairs`, not enough arguments. |
||||||
| pypath.inputs.ipi.ipi_uniprot | 2021-09-10 18:02:19 | 2021-09-10 18:02:19 | 0.0 | dict | {'IPI00807623': {'A0A183'}, 'IPI00396341': {'A0AUZ9'}, 'IPI00884975': {'A0AUZ9'}, 'IPI00884987': {'A0AUZ9'}, 'IPI00885003': {'A0AUZ9'}, 'IPI00855723': {'A0AV02'}, 'IPI00867607': {'A0AV02'}, 'IPI00793608': {'A0AV02'}, 'IPI00867726': {'A0AV02'}, 'IPI00867740': {'A0AV02'}, 'IPI00169342': {'A0AV96'}, 'I...(truncated) | 51,106 | |
| pypath.inputs.iptmnet.iptmnet_interactions | 2021-09-10 18:02:19 | 2021-09-10 18:02:19 | 0.0 | generator | <generator object iptmnet_interactions at 0x7fda96b3e7b0> | None | |
| pypath.inputs.italk.italk_annotations | 2021-09-10 18:02:19 | 2021-09-10 18:02:20 | 1.0 | dict | {'P01023': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'Q07954': {ItalkAnnotation(mainclass='receptor', subclass='other'), ItalkAnnotation(mainclass='receptor', subclass='growth factor')}, 'Q16613': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'P48039': {ItalkAnnotation(main...(truncated) | 1,414 | |
| pypath.inputs.italk.italk_interactions | 2021-09-10 18:02:20 | 2021-09-10 18:02:20 | 0.0 | list | [ItalkInteraction(ligand='P01023', receptor='Q07954', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P48039', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P49286', classification='other'), ItalkInteraction(ligand='P12821', receptor='P50052', classificati...(truncated) | 2,706 | |
| pypath.inputs.italk.italk_raw | 2021-09-10 18:02:20 | 2021-09-10 18:02:20 | 0.0 | DataFrame | Pair.Name ... Classification 0 A2M_LRP1 ... other 1 AANAT_MTNR1A ... other 2 AANAT_MTNR1B ... other 3 ACE_AGTR2 ... other 4 ACE_BDKRB2 ... other ... ... ... ... 2644 CXCL8_KSHV ...(truncated) | 2,649 | |
| pypath.inputs.kea.kea_enzyme_substrate | 2021-09-10 18:02:20 | 2021-09-10 18:02:24 | 4.0 | list | [{'start': None, 'end': None, 'instance': None, 'substrate': 'P08581', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 1349, 'references': {'15475459'}, 'typ': 'phosphorylation'}, {'start': None, 'end': None, 'instance': None, 'substrate': 'P98161', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 432, 'refe...(truncated) | 35,196 | |
| pypath.inputs.kea.kea_interactions | 2021-09-10 18:02:25 | 2021-09-10 18:02:27 | 2.0 | list | [KeaRecord(enzyme='P00519', substrate='P08581', residue_type='Y', residue_offset=1349, pmid='15475459', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', residue_type='Y', residue_offset=432, pmid='12637538', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', resid...(truncated) | 35,196 | |
| pypath.inputs.kegg.kegg_dbget |
Not calling `pypath.inputs.kegg.kegg_dbget`, not enough arguments. |
||||||
| pypath.inputs.kegg.kegg_interactions | 2021-09-10 18:02:27 | 2021-09-10 18:04:34 | 127.0 | list | [KeggInteraction(id_a='Q03113', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcriptional=False), KeggInteraction(id_a='O94763', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcription...(truncated) | 14,332 | |
| pypath.inputs.kegg.kegg_medicus | 2021-09-10 18:04:34 | 2021-09-10 18:04:48 | 14.0 | set | {KeggMedicusRawInteraction(id_a='5604', id_b='5595', name_a='MAP2K1', name_b='MAPK3', effect='stimulation', itype='post_translational', pw_type='pathogen', type_a='gene', type_b='gene', network_id='N00392'), KeggMedicusRawInteraction(id_a='C00046', id_b='23435', name_a='RNA', name_b='TARDBP', effect...(truncated) | 12,600 | |
| pypath.inputs.kegg.kegg_medicus_complexes | 2021-09-10 18:04:48 | 2021-09-10 18:04:49 | 1.0 | dict | {'COMPLEX:Q8TBF5_Q9H3S5': Complex: COMPLEX:Q8TBF5_Q9H3S5, 'COMPLEX:Q01718_Q8TCY5': Complex: COMPLEX:Q01718_Q8TCY5, 'COMPLEX:P01889_P51572': Complex: COMPLEX:P01889_P51572, 'COMPLEX:P30511_P51572': Complex: COMPLEX:P30511_P51572, 'COMPLEX:Q15596_Q92731': Complex: COMPLEX:Q15596_Q92731, 'COMPLEX:P0110...(truncated) | 267 | |
| pypath.inputs.kegg.kegg_medicus_interactions | 2021-09-10 18:04:49 | 2021-09-10 18:04:50 | 1.0 | list | [KeggMedicusInteraction(id_a='Q02750', id_b='P27361', entity_type_a='protein', entity_type_b='protein', interaction_type='post_translational', effect='stimulation'), KeggMedicusInteraction(id_a='P00519', id_b='O94806', entity_type_a='protein', entity_type_b='protein', interaction_type='post_translat...(truncated) | 9,383 | |
| pypath.inputs.kegg.kegg_pathway_annotations | 2021-09-10 18:04:51 | 2021-09-10 18:04:57 | 6.0 | defaultdict | defaultdict(<class 'set'>, {'Q9H2K8': {KeggPathway(pathway='MAPK signaling pathway')}, 'Q12933': {KeggPathway(pathway='Sphingolipid signaling pathway'), KeggPathway(pathway='Necroptosis'), KeggPathway(pathway='TNF signaling pathway'), KeggPathway(pathway='NOD-like receptor signaling pathway'), KeggP...(truncated) | 2,562 | |
| pypath.inputs.kegg.kegg_pathway_annotations_pathwaycommons | 2021-09-10 18:04:57 | 2021-09-10 18:04:58 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'A8K7J7': {KeggPathway(pathway='Starch and sucrose metabolism'), KeggPathway(pathway='Fructose and mannose metabolism'), KeggPathway(pathway='Glycolysis / Gluconeogenesis'), KeggPathway(pathway='Galactose metabolism'), KeggPathway(pathway='Metabolic pathways'), KeggPathwa...(truncated) | 813 | |
| pypath.inputs.kegg.kegg_pathways | 2021-09-10 18:04:58 | 2021-09-10 18:05:04 | 6.0 | tuple | ({'MAPK signaling pathway': {'Q9H2K8', 'Q12933', 'Q16637', 'Q9Y6R4', 'P49116', 'P04792', 'P51452', 'P32248', 'Q15628', 'Q7LDG7', 'P19438', 'P51617', 'P19419', 'P07602', 'O75688', 'P0C869', 'Q9UKG9', 'O94763', 'P10636', 'Q9HC77', 'P19838', 'O95257', 'Q8IW41', 'O43283', 'Q13163', 'P0DMV9', 'Q16584', '...(truncated) | 2 | |
| pypath.inputs.kinasedotcom.kinasedotcom_annotations | 2021-09-10 18:05:04 | 2021-09-10 18:05:09 | 5.0 | defaultdict | defaultdict(<class 'set'>, {'P31749': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'P31751': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'Q9Y243': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'O14578': {KinasedotcomAnnotation(g...(truncated) | 503 | |
| pypath.inputs.kirouac2010.kirouac2010_interactions | 2021-09-10 18:05:09 | 2021-09-10 18:05:13 | 4.0 | list | [('ADIPOQ', 'ADIPOR'), ('AGRP', 'ATRN'), ('AREG', 'EGFR'), ('ANGPTL1', 'TEK'), ('ANGPTL2', 'TEK'), ('ANGPTL3', 'TEK'), ('ANGPTL4', 'TEK'), ('ANGPTL5', 'TEK'), ('ANGPTL6', 'TEK'), ('BTC', 'EGFR'), ('BMP1', 'BMPR'), ('BMP10', 'BMPR'), ('BMP15', 'BMPR'), ('BMP2', 'BMPR'), ('BMP3', 'BMPR'), ('BMP4', 'BM...(truncated) | 267 | |
| pypath.inputs.laudanna.laudanna_directions | 2021-09-10 18:05:13 | 2021-09-10 18:05:13 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/laudanna.py", line 54, in laudanna_directions
LaudannaDirection(
TypeError: <lambda>() missing 1 required positional argument: 'target_genesymbol'
|
|||
| pypath.inputs.laudanna.laudanna_effects | 2021-09-10 18:05:13 | 2021-09-10 18:05:14 | 1.0 | list | [LaudannaEffect(source_genesymbol='EDNRA', target_genesymbol='NBN', effect='activation'), LaudannaEffect(source_genesymbol='TGFB1', target_genesymbol='TGFB1', effect='inhibition'), LaudannaEffect(source_genesymbol='EIF5B', target_genesymbol='RPL11', effect='activation'), LaudannaEffect(source_genesy...(truncated) | 63,438 | |
| pypath.inputs.li2012.get_li2012 | 2021-09-10 18:05:14 | 2021-09-10 18:05:37 | 23.0 | filter | <filter object at 0x7fdace4d9a00> | None | |
| pypath.inputs.li2012.li2012_dmi | 2021-09-10 18:05:37 | 2021-09-10 18:05:37 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/li2012.py", line 131, in li2012_dmi
se = uniprot_input.swissprot_seq(isoforms = True)
NameError: name 'uniprot_input' is not defined
|
|||
| pypath.inputs.li2012.li2012_enzyme_substrate | 2021-09-10 18:05:37 | 2021-09-10 18:05:37 | 0.0 | list | [{'substrate': 'BCR', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 177}, {'substrate': 'CAV1', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 14}, {'substrate': 'CBL', 'kinase': 'ABL', 'instance': None, 'start': None, ...(truncated) | 349 | |
| pypath.inputs.li2012.li2012_interactions | 2021-09-10 18:05:37 | 2021-09-10 18:05:37 | 0.0 | list | [['ABL', 'BCR', 'CTK_Cytoplasm', 'phosphorylation'], ['BCR', 'PTPN', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['BCR', 'GRB2', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['ABL', 'CAV1', 'CTK_Membrane', 'phosphorylation'], ['CAV1', 'GRB7', 'CTK_Membrane', 'phosphomotif_binding'], ['ABL', 'CBL', 'CTK_C...(truncated) | 503 | |
| pypath.inputs.lincs.lincs_compounds | 2021-09-10 18:05:37 | 2021-09-10 18:05:40 | 3.0 | dict | {'10001': LincsCompound(lincs='LSM-1001', chembl='CHEMBL14762', chebi='CHEBI:354.22', inchi='InChI=1S/C19H26N6O/c1-4-15(11-26)22-19-23-17(20-10-14-8-6-5-7-9-14)16-18(24-19)25(12-21-16)13(2)3/h5-9,12-13,15,26H,4,10-11H2,1-3H3,(H2,20,22,23,24)/t15-/m1/s1', inchi_key='BTIHMVBBUGXLCJ-OAHLLOKOSA-N', smil...(truncated) | 1,320 | |
| pypath.inputs.lmpid.lmpid_dmi | 2021-09-10 18:05:40 | 2021-09-10 18:05:41 | 1.0 | list | [{'motif_protein': 'P54253', 'domain_protein': 'P62258', 'instance': 'RRWSAP', 'motif_start': 772, 'motif_end': 777, 'domain_name': '14-3-3 domain', 'domain_name_type': 'name', 'refs': ['20037628', '12757707']}, {'motif_protein': 'P54253', 'domain_protein': 'P63104', 'instance': 'RRWSAP', 'motif_sta...(truncated) | 1,170 | |
| pypath.inputs.lmpid.lmpid_interactions | 2021-09-10 18:05:41 | 2021-09-10 18:05:42 | 1.0 | list | [['P62258', 'P54253', '20037628;12757707'], ['P63104', 'P54253', '20037628;12757707'], ['P63104', 'P04049', '8601312'], ['P27348', 'P04049', '8601312'], ['P31946', 'P04049', '8601312'], ['Q04917', 'P04049', '8601312'], ['P63104', 'Q99683', '10411906'], ['P63104', 'P98177', '14690436'], ['P62258', 'O...(truncated) | 1,170 | |
| pypath.inputs.lmpid.load_lmpid | 2021-09-10 18:05:42 | 2021-09-10 18:05:43 | 1.0 | list | [{'bait': 'P54253', 'prey': 'P62258', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P54253', 'prey': 'P63104', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P04049', 'prey': 'P6310...(truncated) | 1,170 | |
| pypath.inputs.lncdisease.lncdisease_interactions | 2021-09-10 18:05:43 | 2021-09-10 18:05:43 | 0.0 | list | [LncdiseaseInteraction(source='7SK', target='ABO', source_type='RNA', target_type='RNA', mechanism='regulatory', organism='human', pmid='22522162'), LncdiseaseInteraction(source='7SK', target='Ars2', source_type='RNA', target_type='Protein', mechanism='regulatory', organism='human', pmid='22244333')...(truncated) | 478 | |
| pypath.inputs.lncrnadb.lncrnadb_interactions | 2021-09-10 18:05:43 | 2021-09-10 18:05:44 | 1.0 | list | [LncrnadbInteraction(lncrna='Maternal somatic nucleus RNAs', partner='Scan RNAs', type='transcript', organism='Paramecium tetraurelia', pmid='19103667'), LncrnadbInteraction(lncrna='G22', partner='PABP', type='protein', organism='Loris tardigradus', pmid='17175535'), LncrnadbInteraction(lncrna='G22'...(truncated) | 773 | |
| pypath.inputs.locate.locate_localizations | 2021-09-10 18:05:44 | 2021-09-10 18:05:44 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/locate.py", line 63, in locate_localizations
c.result[fname]
TypeError: 'NoneType' object is not subscriptable
|
|||
| pypath.inputs.lrdb.lrdb_annotations | 2021-09-10 18:05:44 | 2021-09-10 18:05:44 | 0.0 | dict | {'P01023': {LrdbAnnotation(role='ligand', cell_type=None, sources=('Fantom5', 'HPMR', 'HPRD'), references=('10652313',))}, 'Q07954': {LrdbAnnotation(role='receptor', cell_type=None, sources=('Fantom5', 'HPRD'), references=('11854294',)), LrdbAnnotation(role='receptor', cell_type=None, sources=('Fant...(truncated) | 1,536 | |
| pypath.inputs.lrdb.lrdb_interactions | 2021-09-10 18:05:44 | 2021-09-10 18:05:44 | 0.0 | list | [LrdbRecord(ligand_genesymbol='A2M', receptor_genesymbol='LRP1', sources=['Fantom5', 'HPMR', 'HPRD'], references=['10652313'], ligand_cells=[], receptor_cells=[]), LrdbRecord(ligand_genesymbol='AANAT', receptor_genesymbol='MTNR1A', sources=['Fantom5', 'HPMR'], references=['12943195'], ligand_cells=[...(truncated) | 3,251 | |
| pypath.inputs.macrophage._trim_gname |
Not calling `pypath.inputs.macrophage._trim_gname`, not enough arguments. |
||||||
| pypath.inputs.macrophage.macrophage_interactions | 2021-09-10 18:05:44 | 2021-09-10 18:05:45 | 1.0 | list | [MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16497931'), MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16965765'), Macro...(truncated) | 4,516 | |
| pypath.inputs.matrisome.__matrisome_annotations_2 | 2021-09-10 18:05:45 | 2021-09-10 18:06:01 | 16.0 | set | {'SERPINB8', 'WNT6', 'GPC6', 'COL14A1', 'Lamb1', 'FBN2', 'Fgb', 'Thsd4', 'TINAG', 'COL25A1', 'Tgfbi', 'Bmper', 'CLC', 'IL17D', 'PPBP', 'Col23a1', 'ST14', 'TCHH', 'Gpc4', 'CXCL13', 'ADAMTSL4', 'P4HA1', 'THBS2', 'CLEC18B', 'NRG2', 'COL22A1', 'Col8a1', 'Muc4', 'IGFBP5', 'Matn1', 'Ctsb', 'Mmrn2', 'SNED1...(truncated) | 744 | |
| pypath.inputs.matrisome.matrisome_annotations | 2021-09-10 18:06:01 | 2021-09-10 18:06:01 | 0.0 | dict | {'Q7Z7G0': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'B4DSV9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'Q5JPC9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycopro...(truncated) | 1,064 | |
| pypath.inputs.matrixdb._matrixdb_protein_list |
Not calling `pypath.inputs.matrixdb._matrixdb_protein_list`, not enough arguments. |
||||||
| pypath.inputs.matrixdb.matrixdb_annotations | 2021-09-10 18:06:01 | 2021-09-10 18:06:04 | 3.0 | dict | {'P08172': {MatrixdbAnnotation(mainclass='membrane')}, 'O43237': {MatrixdbAnnotation(mainclass='membrane')}, 'Q95460': {MatrixdbAnnotation(mainclass='membrane'), MatrixdbAnnotation(mainclass='secreted')}, 'O43374': {MatrixdbAnnotation(mainclass='membrane')}, 'Q86YJ7': {MatrixdbAnnotation(mainclass='...(truncated) | 10,100 | |
| pypath.inputs.matrixdb.matrixdb_ecm_proteins | 2021-09-10 18:06:04 | 2021-09-10 18:06:05 | 1.0 | set | {'Q9UQP3', 'O15335', 'P21754', 'P51511', 'Q6ZRI0', 'O00339', 'Q99435', 'Q66K79', 'Q92896', 'Q8N6G6', 'Q96A83', 'P05186', 'Q6UXK5', 'Q9Y5L3', 'Q99727', 'Q53GQ0', 'O75339', 'Q5SZK8', 'P20908', 'P51693', 'Q7Z304', 'O00515', 'P12644', 'Q8TE56', 'P56704', 'Q16787', 'Q9UBV4', 'P78509', 'Q16363', 'P07359',...(truncated) | 483 | |
| pypath.inputs.matrixdb.matrixdb_interactions | 2021-09-10 18:06:05 | 2021-09-10 18:06:05 | 0.0 | list | [['P13497', 'Q15113', '20979576', 'protease assay'], ['O00206', 'P21810', '24480070', 'microscale thermophoresis'], ['P49747', 'O15232', '22521401', 'enzyme linked immunosorbent assay'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O...(truncated) | 425 | |
| pypath.inputs.matrixdb.matrixdb_membrane_proteins | 2021-09-10 18:06:05 | 2021-09-10 18:06:07 | 2.0 | set | {'P08172', 'O43237', 'Q95460', 'O43374', 'Q86YJ7', 'Q8TDU5', 'O60635', 'Q8N6Q1', 'P0DMS8', 'Q8NB66', 'Q6UX71', 'Q9Y597', 'Q8N4M1', 'Q12908', 'Q76MJ5', 'Q9Y5L3', 'Q9Y4D1', 'Q6UXP3', 'Q8NGT7', 'Q7Z3B1', 'O95081', 'Q14142', 'Q2T9K0', 'Q8NGG2', 'Q8WZA2', 'Q9BZV3', 'Q13606', 'A6NLX4', 'Q01650', 'Q9Y4I1',...(truncated) | 8,242 | |
| pypath.inputs.matrixdb.matrixdb_secreted_proteins | 2021-09-10 18:06:07 | 2021-09-10 18:06:07 | 0.0 | set | {'P08118', 'Q9Y2L6', 'P68133', 'Q9P0G3', 'Q9UL52', 'Q95460', 'Q86VR8', 'A0A075B6J9', 'O95025', 'Q6UX71', 'P47929', 'Q86Y29', 'P01699', 'Q96A83', 'Q8N2G8', 'P16870', 'Q99727', 'P08476', 'P30530', 'Q8WUM4', 'P20908', 'Q7Z304', 'P81277', 'Q8ND30', 'P09958', 'Q7Z3B1', 'Q16048', 'O60894', 'P0DMC3', 'P073...(truncated) | 2,925 | |
| pypath.inputs.mcam.mcam_cell_adhesion_molecules | 2021-09-10 18:06:07 | 2021-09-10 18:06:08 | 1.0 | set | {'P16150', 'Q9UQS6', 'Q14956', 'Q8TEW0', 'P62079', 'Q8WWQ8', 'Q13835', 'P20702', 'Q92692', 'P28827', 'O95471', 'Q7Z3B1', 'Q6NW40', 'Q9BXN2', 'O75144', 'P07359', 'Q8IUX7', 'Q9NPY3', 'P16284', 'Q9BY67', 'Q13797', 'P12259', 'Q12860', 'Q99418', 'P53708', 'P50895', 'Q15223', 'P78325', 'Q8TES5', 'P25942',...(truncated) | 103 | |
| pypath.inputs.membranome.membranome_annotations | 2021-09-10 18:06:08 | 2021-09-10 18:06:08 | 0.0 | generator | <generator object membranome_annotations at 0x7fda9a26c190> | None | |
| pypath.inputs.mimp.get_kinase_class | 2021-09-10 18:06:08 | 2021-09-10 18:06:09 | 1.0 | dict | {'groups': {'AGC': ['AKT1', 'AKT2', 'AKT3', 'DMPK1', 'DMPK2', 'MRCKb', 'MRCKa', 'MRCK', 'ROCK2', 'ROCK1', 'CRIK', 'BARK1', 'BARK2', 'GPRK4', 'GPRK5', 'GPRK6', 'RHOK', 'GPRK6', 'GPRK7', 'MAST3', 'MAST2', 'MAST1', 'MASTL', 'MAST4', 'NDR1', 'LATS1', 'LATS2', 'NDR2', 'PKACa', 'PKACb', 'PKACg', 'PRKX', '...(truncated) | 4 | |
| pypath.inputs.mimp.mimp_enzyme_substrate | 2021-09-10 18:06:09 | 2021-09-10 18:06:11 | 2.0 | list | [{'instance': 'VVGARRSSWRVISSI', 'kinase': 'PDKC', 'resaa': 'S', 'resnum': 60, 'npmid': 8, 'substrate_refseq': 'NM_003404', 'substrate': 'YWHAB', 'start': 53, 'end': 67, 'databases': ['HPRD', 'phosphoELM', 'PhosphoSite']}, {'instance': 'VVGARRSSWRVISSI', 'kinase': 'PRKCD', 'resaa': 'S', 'resnum': 60...(truncated) | 17,030 | |
| pypath.inputs.mimp.mimp_interactions | 2021-09-10 18:06:11 | 2021-09-10 18:06:12 | 1.0 | list | [['PDKC', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCD', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCZ', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PDKC', 'YWHAH', ['phosphoELM', 'PhosphoSite']], ['ATM', 'EIF4EBP1', ['phosphoELM', 'PhosphoSite']], ['RORC', 'EIF4EBP1', ...(truncated) | 17,030 | |
| pypath.inputs.mir2disease.mir2disease_interactions | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | list | [Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='KRAS', year='2008', sentence="A SNP in a let-7 microRNA complementary site in the KRAS 3' untranslated region increases non-small cell lung cancer risk."), Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='HMGA2', year='2008'...(truncated) | 805 | |
| pypath.inputs.mirbase.get_mirbase_aliases | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | tuple | ({'MIMAT0000062': {'hsa-let-7a-5p', 'hsa-let-7a'}, 'MIMAT0000063': {'hsa-let-7b-5p', 'hsa-let-7b'}, 'MIMAT0000064': {'hsa-let-7c-5p', 'hsa-let-7c'}, 'MIMAT0000065': {'hsa-let-7d', 'hsa-let-7d-5p'}, 'MIMAT0000066': {'hsa-let-7e-5p', 'hsa-let-7e'}, 'MIMAT0000067': {'hsa-let-7f', 'hsa-let-7f-5p'}, 'MIM...(truncated) | 2 | |
| pypath.inputs.mirbase.mirbase_ids | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | generator | <generator object mirbase_ids at 0x7fdad63d9200> | None | |
| pypath.inputs.mirbase.mirbase_mature | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | generator | <generator object mirbase_mature at 0x7fdad63d9200> | None | |
| pypath.inputs.mirbase.mirbase_mature_all | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | list | ['MIMAT0000062', 'MIMAT0000062', 'MIMAT0000062', 'MIMAT0000063', 'MIMAT0000064', 'MIMAT0000065', 'MIMAT0000066', 'MIMAT0000067', 'MIMAT0000067', 'MIMAT0000068', 'MIMAT0000069', 'MIMAT0000069', 'MIMAT0000070', 'MIMAT0000071', 'MIMAT0000072', 'MIMAT0000073', 'MIMAT0000074', 'MIMAT0000074', 'MIMAT00000...(truncated) | 3,027 | |
| pypath.inputs.mirbase.mirbase_precursor | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | generator | <generator object mirbase_precursor at 0x7fdad63d9200> | None | |
| pypath.inputs.mirbase.mirbase_precursor_all | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | list | ['MI0000060', 'MI0000062', 'MI0000061', 'MI0000063', 'MI0000064', 'MI0000065', 'MI0000066', 'MI0000067', 'MI0000068', 'MI0000069', 'MI0000070', 'MI0000115', 'MI0000071', 'MI0000071', 'MI0000072', 'MI0000073', 'MI0000074', 'MI0000075', 'MI0000076', 'MI0000077', 'MI0000078', 'MI0000079', 'MI0000485', ...(truncated) | 3,027 | |
| pypath.inputs.mirbase.mirbase_precursor_to_mature | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | generator | <generator object mirbase_precursor_to_mature at 0x7fdad63d9120> | None | |
| pypath.inputs.mirdeathdb.mirdeathdb_interactions | 2021-09-10 18:06:12 | 2021-09-10 18:06:12 | 0.0 | generator | <generator object mirdeathdb_interactions at 0x7fdad63d9190> | None | |
| pypath.inputs.mirecords.mirecords_interactions | 2021-09-10 18:06:12 | 2021-09-10 18:06:17 | 5.0 | list | [MirecordsInteraction(mirna_name='hsa-miR-23a', target_refseq='NM_198155', target_genesymbol='C21orf33', mirna_organism='Homo sapiens', target_organism='Homo sapiens', pmid='12808467'), MirecordsInteraction(mirna_name='mmu-miR-434-3p', target_refseq='NM_184109', target_genesymbol='Rtl1', mirna_organ...(truncated) | 3,106 | |
| pypath.inputs.mirtarbase._mirtarbase_interactions |
Not calling `pypath.inputs.mirtarbase._mirtarbase_interactions`, not enough arguments. |
||||||
| pypath.inputs.mirtarbase.mirtarbase_interactions | 2021-09-10 18:06:17 | 2021-09-10 18:06:37 | 20.0 | list | [MirtarbaseInteraction(mirtarbase_id='MIRT003135', mirna_name='mmu-miR-122-5p', mirna_organism='Mus musculus', target_genesymbol='Cd320', target_entrez='54219', target_organism='Mus musculus', target_site='AGAGACTGGGGTCCTCAGACACTCCC', method='Luciferase reporter assay//qRT-PCR//Western blot', catego...(truncated) | 21,560 | |
| pypath.inputs.mitab.mitab_field_list |
Not calling `pypath.inputs.mitab.mitab_field_list`, not enough arguments. |
||||||
| pypath.inputs.mitab.mitab_field_uniprot |
Not calling `pypath.inputs.mitab.mitab_field_uniprot`, not enough arguments. |
||||||
| pypath.inputs.mppi.mppi_interactions | 2021-09-10 18:06:37 | 2021-09-10 18:06:37 | 0.0 | list | [['9867828', '9867828', 'P05109', 'SP', 'S100A8;CAGA;MRP8; calgranulin A (migration inhibitory factor-related protein 8)', '9606', 'P06702', 'SP', 'S100A9;CAGB;MRP14; calgranulin B (migration inhibitory factor-related protein 14)', '9606'], ['9867828', '9867828', 'P06702', 'SP', 'S100A9;CAGB;MRP14; ...(truncated) | 777 | |
| pypath.inputs.msigdb.msigdb_annotations | 2021-09-10 18:06:37 | 2021-09-10 18:06:42 | 5.0 | dict | {} | 0 | |
| pypath.inputs.msigdb.msigdb_download | 2021-09-10 18:06:42 | 2021-09-10 18:06:43 | 1.0 | dict | {} | 0 | |
| pypath.inputs.msigdb.msigdb_download_collections | 2021-09-10 18:06:43 | 2021-09-10 18:06:48 | 5.0 | dict | {('hallmark', 'h.all'): {}, ('positional', 'c1.all'): {}, ('chemical_and_genetic_perturbations', 'c2.cgp'): {}, ('biocarta_pathways', 'c2.cp.biocarta'): {}, ('kegg_pathways', 'c2.cp.kegg'): {}, ('pid_pathways', 'c2.cp.pid'): {}, ('reactome_pathways', 'c2.cp.reactome'): {}, ('mirna_targets', 'c3.mir'...(truncated) | 13 | |
| pypath.inputs.ncrdeathdb.ncrdeathdb_interactions | 2021-09-10 18:06:48 | 2021-09-10 18:06:51 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/ncrdeathdb.py", line 71, in ncrdeathdb_interactions
NcrdeathdbInteraction(
TypeError: <lambda>() got an unexpected keyword argument 'protein'
|
|||
| pypath.inputs.negatome.negatome_interactions | 2021-09-10 18:06:51 | 2021-09-10 18:06:51 | 0.0 | list | [NegatomeInteraction(uniprot_a='Q6ZNK6', uniprot_b='Q9Y4K3', pmid='15047173', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='Q9NR31', uniprot_b='Q15797', pmid='17356069', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='P11627', uniprot_b='P53986', pmid='20155396', me...(truncated) | 2,171 | |
| pypath.inputs.netbiol._netbiol_interactions |
Not calling `pypath.inputs.netbiol._netbiol_interactions`, not enough arguments. |
||||||
| pypath.inputs.netbiol.arn_interactions | 2021-09-10 18:06:51 | 2021-09-10 18:06:51 | 0.0 | list | [ArnInteraction(source_uniprot='O15350', target_uniprot='O95352', is_direct='0', is_directed='1', effect='0', source_autophagy='0', target_autophagy='1', references='19001857'), ArnInteraction(source_uniprot='O15350', target_uniprot='Q9H1Y0', is_direct='0', is_directed='1', effect='0', source_autoph...(truncated) | 95 | |
| pypath.inputs.netbiol.nrf2ome_interactions | 2021-09-10 18:06:51 | 2021-09-10 18:06:51 | 0.0 | list | [Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='O15379', is_direct='1', is_directed='0', effect='0', references='18241676'), Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='Q16236', is_direct='0', is_directed='1', effect='-1', references='18241676'), Nrf2omeInteraction(sourc...(truncated) | 109 | |
| pypath.inputs.netpath.netpath_interactions | 2021-09-10 18:06:51 | 2021-09-10 18:06:53 | 2.0 | list | [['IL4R', '3566', 'IL4R', '3566', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL4R', '3566', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL2RG', '3561', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleu...(truncated) | 7,555 | |
| pypath.inputs.netpath.netpath_names | 2021-09-10 18:06:53 | 2021-09-10 18:06:53 | 0.0 | dict | {'137': 'Advanced glycation end-products (AGE/RAGE)', '1': 'Alpha6 Beta4 Integrin', '2': 'Androgen receptor (AR)', '12': 'B cell receptor (BCR)', '76': 'Brain-derived neurotrophic factor (BDNF)', '129': 'Corticotropin-releasing hormone (CRH)', '4': 'Epidermal growth factor receptor (EGFR)', '25': 'F...(truncated) | 35 | |
| pypath.inputs.netpath.netpath_pathway_annotations | 2021-09-10 18:06:53 | 2021-09-10 18:07:10 | 17.0 | defaultdict | defaultdict(<class 'set'>, {'Q15109': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'O95831': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P54819': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P31749': {NetpathPathway(...(truncated) | 1,868 | |
| pypath.inputs.ontology.listof_ontologies | 2021-09-10 18:07:10 | 2021-09-10 18:07:11 | 1.0 | dict | {'aeo': 'Anatomical Entity Ontology', 'afo': 'Allotrope Merged Ontology Suite', 'agro': 'Agronomy Ontology', 'aism': 'Ontology for the Anatomy of the Insect SkeletoMuscular system', 'amphx': 'Amphioxus Development and Anatomy Ontology (AMPHX)', 'apo': 'Ascomycete Phenotype Ontology (APO)', 'apollo_s...(truncated) | 265 | |
| pypath.inputs.ontology.ontology |
Not calling `pypath.inputs.ontology.ontology`, not enough arguments. |
||||||
| pypath.inputs.opm.opm_annotations | 2021-09-10 18:07:12 | 2021-09-10 18:07:22 | 10.0 | defaultdict | defaultdict(<class 'set'>, {'O14745': {OpmAnnotation(membrane='Eykaryo. plasma', family='FXYD regulators', transmembrane=True)}, 'P08842': {OpmAnnotation(membrane='Endoplasm. reticulum', family='Sulfatase', transmembrane=True)}, 'P59666': {OpmAnnotation(membrane='Secreted', family='Vertebrate defens...(truncated) | 393 | |
| pypath.inputs.oreganno.oreganno_interactions | 2021-09-10 18:07:22 | 2021-09-10 18:07:22 | 0.0 | generator | <generator object oreganno_interactions at 0x7fdaee60f890> | None | |
| pypath.inputs.oreganno.oreganno_raw | 2021-09-10 18:07:22 | 2021-09-10 18:07:22 | 0.0 | generator | <generator object oreganno_raw at 0x7fdaee60f890> | None | |
| pypath.inputs.pathwaycommons._create_single_resource_method |
Not calling `pypath.inputs.pathwaycommons._create_single_resource_method`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons.pathwaycommons_interactions | 2021-09-10 18:07:22 | 2021-09-10 18:07:36 | 14.0 | list | [PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='ANXA7', resource='IntAct'), PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='CDKN1A', resource='IntAct'), PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='FD...(truncated) | 1,261,865 | |
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
||||||
| pypath.inputs.pazar.pazar_interactions | 2021-09-10 18:07:37 | 2021-09-10 18:07:37 | 0.0 | list | [PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='9571041'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG...(truncated) | 16,386 | |
| pypath.inputs.pdb.pdb_chains | 2021-09-10 18:07:37 | 2021-09-10 18:07:43 | 6.0 | tuple | ({'P02185': [{'pdb': '101m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset': 1}, {'pdb': '102m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset':...(truncated) | 2 | |
| pypath.inputs.pdb.pdb_complexes | 2021-09-10 18:07:45 | 2021-09-10 18:07:52 | 7.0 | dict | {'COMPLEX:P00720': Complex: COMPLEX:P00720, 'COMPLEX:P09211': Complex: COMPLEX:P09211, 'COMPLEX:P00817': Complex: COMPLEX:P00817, 'COMPLEX:P00963': Complex: COMPLEX:P00963, 'COMPLEX:P00669': Complex: COMPLEX:P00669, 'COMPLEX:P07378': Complex: COMPLEX:P07378, 'COMPLEX:P01837_P01869': Complex: COMPLEX...(truncated) | 38,297 | |
| pypath.inputs.pdb.pdb_uniprot | 2021-09-10 18:07:52 | 2021-09-10 18:07:54 | 2.0 | tuple | ({'P02185': {('1mtj', 'X-ray', 1.7), ('1a6n', 'X-ray', 1.15), ('1swm', 'X-ray', 1.8), ('1mln', 'X-ray', 2.0), ('1mti', 'X-ray', 1.9), ('1v9q', 'X-ray', 1.45), ('2oha', 'X-ray', 1.8), ('4nxc', 'X-ray', 1.55), ('1ch5', 'X-ray', 2.1), ('5zzf', 'X-ray', 1.6), ('1mbc', 'X-ray', 1.5), ('111m', 'X-ray', 1....(truncated) | 2 | |
| pypath.inputs.pdzbase.pdzbase_interactions | 2021-09-10 18:07:55 | 2021-09-10 18:07:55 | 0.0 | list | [PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P13569', isoform_ligand=1, genesymbol_pdz='NHERF-1', genesymbol_ligand='CFTR', pdz_domain=1, organism=9606, pubmed=9613608), PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P40879', isoform_ligand=1, gen...(truncated) | 339 | |
| pypath.inputs.pepcyber.pepcyber_details |
Not calling `pypath.inputs.pepcyber.pepcyber_details`, not enough arguments. |
||||||
| pypath.inputs.pepcyber.pepcyber_interactions | 2021-09-10 18:07:55 | 2021-09-10 18:07:56 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/pepcyber.py", line 112, in pepcyber_interactions
c = curl.Curl(url, silent = False, timeout = 600)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/share/curl.py", line 946, in __init__
self.process_file()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/share/curl.py", line 1620, in process_file
self.extract_file()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/share/curl.py", line 1650, in extract_file
self.extract()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/share/curl.py", line 619, in extract
getattr(self, 'open_%s' % self.type)()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/share/curl.py", line 743, in open_plain
self.result = self.fileobj.read()
File "/usr/lib/python3.9/codecs.py", line 322, in decode
(result, consumed) = self._buffer_decode(data, self.errors, final)
UnicodeDecodeError: 'utf-8' codec can't decode byte 0xd5 in position 7716714: invalid continuation byte
|
|||
| pypath.inputs.pfam._pfam_uniprot |
Not calling `pypath.inputs.pfam._pfam_uniprot`, not enough arguments. |
||||||
| pypath.inputs.pfam.pfam_names | 2021-09-10 18:07:56 | 2021-09-10 18:08:00 | 4.0 | tuple | ({'PFAM_NAME': {'PFAM_ACCESSION'}, 'Globin': {'PF00042'}, 'Phage_lysozyme': {'PF00959'}, 'GST_N': {'PF02798'}, 'GST_C_3': {'PF14497'}, 'DNA_methylase': {'PF00145'}, 'Pyrophosphatase': {'PF00719'}, 'AsnA': {'PF03590'}, 'RnaseA': {'PF00074'}, 'Ras': {'PF00071'}, 'Carb_anhydrase': {'PF00194'}, 'Lys': {...(truncated) | 2 | |
| pypath.inputs.pfam.pfam_pdb | 2021-09-10 18:08:00 | 2021-09-10 18:08:02 | 2.0 | tuple | (defaultdict(<class 'dict'>, {'101m': {'PF00042': PfamDomain(chain='A', start=7, end=113)}, '102l': {'PF00959': PfamDomain(chain='A', start=24, end=149)}, '102m': {'PF00042': PfamDomain(chain='A', start=7, end=113)}, '103l': {'PF00959': PfamDomain(chain='A', start=24, end=151)}, '103m': {'PF00042': ...(truncated) | 2 | |
| pypath.inputs.pfam.pfam_regions | 2021-09-10 18:08:02 | 2021-09-10 18:08:02 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/pfam.py", line 190, in pfam_regions
organism = taxnomy.ensure_ncbi_tax_id(organism)
NameError: name 'taxnomy' is not defined
|
|||
| pypath.inputs.pfam.pfam_uniprot | 2021-09-10 18:08:02 | 2021-09-10 18:12:49 | 287.0 | tuple | ({'P13727': {'PF00059'}, 'O43290': {'PF03343'}, 'O14603': set(), 'P13631': {'PF00105', 'PF00104'}, 'Q9Y3Q8': {'PF01166'}, 'A6NJY4': {'PF15125'}, 'A0A539': {'PF07686'}, 'Q969K7': {'PF12304'}, 'P26006': {'PF01839', 'PF08441'}, 'Q9Y6J8': {'PF00581'}, 'Q2MV58': {'PF07773'}, 'Q2T9K0': set(), 'P35269': {'...(truncated) | 2 | |
| pypath.inputs.phobius.phobius_annotations | 2021-09-10 18:12:49 | 2021-09-10 18:12:49 | 0.0 | dict | {'P01920': {PhobiusAnnotation(tm_helices=1, signal_peptide=True, cytoplasmic=1, non_cytoplasmic=1)}, 'P18440': {PhobiusAnnotation(tm_helices=0, signal_peptide=False, cytoplasmic=0, non_cytoplasmic=1)}, 'P00740': {PhobiusAnnotation(tm_helices=0, signal_peptide=True, cytoplasmic=0, non_cytoplasmic=1)}...(truncated) | 20,350 | |
| pypath.inputs.phosphatome.phosphatome_annotations | 2021-09-10 18:12:49 | 2021-09-10 18:12:49 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphatome.py", line 50, in phosphatome_annotations
tbl = inputs_common.read_xls(c.result['aag1796_Tables S1 to S23.xlsx'])
TypeError: 'NoneType' object is not subscriptable
|
|||
| pypath.inputs.phosphoelm.phosphoelm_enzyme_substrate | 2021-09-10 18:12:49 | 2021-09-10 18:12:51 | 2.0 | list | [{'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 204, 'start': None, 'end': None, 'substrate': 'O14543', 'kinase': 'P06239', 'references': ['12783885'], 'experiment': 'LTP', 'organism': 'Homo sapiens'}, {'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 221, 'start': None, 'end': None...(truncated) | 2,426 | |
| pypath.inputs.phosphoelm.phosphoelm_interactions | 2021-09-10 18:12:51 | 2021-09-10 18:12:52 | 1.0 | list | [['P06239', 'O14543', '12783885', 'Homo sapiens'], ['P06239', 'O14543', '15173187', 'Homo sapiens'], ['P12931', 'O14746', '12808100', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'], ['P06241', 'O15117', '10570256', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'],...(truncated) | 2,426 | |
| pypath.inputs.phosphoelm.phosphoelm_kinases | 2021-09-10 18:12:52 | 2021-09-10 18:12:52 | 0.0 | dict | {'AAK1': 'Q2M2I8', 'Abl': 'P00519', 'Abl2': 'P42684', 'Abl_drome': 'P00522', 'Ack_drome': 'Q9VZI2', 'AFK': 'P80197', 'Akt1_drome': 'Q8INB9', 'ALK': 'Q9UM73', 'Atg1_drome': 'Q9VU14', 'ATM': 'Q13315', 'ATR': 'Q13535', 'Aurora A': 'O14965', 'Aurora B': 'Q96GD4', 'Axl': 'P30530', 'BCKDK': 'O14874', 'BLK...(truncated) | 247 | |
| pypath.inputs.phosphoelm.phosphoelm_psites | 2021-09-10 18:12:52 | 2021-09-10 18:12:52 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphoelm.py", line 125, in phosphoelm_psites
l.append('1' if '-' not in l[0] else l[0].split('-')[1])
AttributeError: 'dict' object has no attribute 'append'
|
|||
| pypath.inputs.phosphonetworks.phosphonetworks_enzyme_substrate | 2021-09-10 18:12:52 | 2021-09-10 18:12:53 | 1.0 | list | [{'instance': 'SSYGISETTLEEIFL', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1242, 'score': 1.0162, 'substrate': 'ABCA1', 'start': 1235, 'end': 1249}, {'instance': 'SYGISETTLEEIFLK', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1243, 'score': 1.0455, 'substrate': 'ABCA1', 'start': 1236, 'end': 1250...(truncated) | 4,417 | |
| pypath.inputs.phosphonetworks.phosphonetworks_interactions | 2021-09-10 18:12:53 | 2021-09-10 18:12:53 | 0.0 | list | [['CDK4', 'UBTF'], ['CAMKK1', 'PSPC1'], ['TNNI3K', 'RUVBL2'], ['DYRK1B', 'NFATC4'], ['MAPK9', 'MAPK8IP1'], ['PXK', 'PRKD2'], ['CSNK2A1', 'RMI1'], ['CSNK2A1', 'HSP90AA1'], ['STK16', 'EIF4H'], ['GRK5', 'C13orf15'], ['STK17A', 'SLC4A1AP'], ['CAMK2A', 'PRKCD'], ['MATK', 'FGR'], ['CSNK2A1', 'WAS'], ['BUB...(truncated) | 1,821 | |
| pypath.inputs.phosphopoint.phosphopoint_directions | 2021-09-10 18:12:53 | 2021-09-10 18:12:53 | 0.0 | list | [('AKT1', 'AKT1'), ('AKT1', 'AKT2'), ('AKT1', 'ESR2'), ('AKT1', 'PHLPP'), ('AKT1', 'APPL'), ('AKT1', 'TCL6'), ('AKT1', 'GRB10'), ('AKT1', 'HSP90AA1'), ('AKT1', 'HSP90AB1'), ('AKT1', 'APLP2'), ('AKT1', 'IKBKB'), ('AKT1', 'ILK'), ('AKT1', 'IMPDH2'), ('AKT1', 'IRS1'), ('AKT1', 'KRT10'), ('AKT1', 'MDM4'...(truncated) | 9,269 | |
| pypath.inputs.phosphopoint.phosphopoint_interactions | 2021-09-10 18:12:53 | 2021-09-10 18:12:53 | 0.0 | list | [PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT1', target_entrez='207', category='Category 2'), PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT2', target_entrez='208', category='Category 2'), PhosphopointInt...(truncated) | 9,269 | |
| pypath.inputs.phosphosite._phosphosite_filter_organism |
Not calling `pypath.inputs.phosphosite._phosphosite_filter_organism`, not enough arguments. |
||||||
| pypath.inputs.phosphosite.phosphosite_directions | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 1124, in phosphosite_directions
curated, noref = phosphosite_interactions()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 678, in phosphosite_interactions
bpax = c.gzfile
AttributeError: 'Curl' object has no attribute 'gzfile'
|
|||
| pypath.inputs.phosphosite.phosphosite_enzyme_substrate | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 68, in phosphosite_enzyme_substrate
data = inputs_common.read_table(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 228, in read_table
_ = next(fileObject)
TypeError: 'NoneType' object is not an iterator
|
|||
| pypath.inputs.phosphosite.phosphosite_interactions | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 679, in phosphosite_interactions
xml = ET.parse(bpax)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 1229, in parse
tree.parse(source, parser)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 580, in parse
self._root = parser._parse_whole(source)
File "/usr/lib/python3.9/gzip.py", line 300, in read
return self._buffer.read(size)
File "/usr/lib/python3.9/_compression.py", line 68, in readinto
data = self.read(len(byte_view))
File "/usr/lib/python3.9/gzip.py", line 487, in read
if not self._read_gzip_header():
File "/usr/lib/python3.9/gzip.py", line 435, in _read_gzip_header
raise BadGzipFile('Not a gzipped file (%r)' % magic)
gzip.BadGzipFile: Not a gzipped file (b'er')
|
|||
| pypath.inputs.phosphosite.phosphosite_interactions_all | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 1133, in phosphosite_interactions_all
return phosphosite_interactions_curated() + phosphosite_interactions_noref()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 1093, in phosphosite_interactions_curated
curated, noref = phosphosite_interactions(ncbi_tax_id = ncbi_tax_id)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 679, in phosphosite_interactions
xml = ET.parse(bpax)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 1229, in parse
tree.parse(source, parser)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 580, in parse
self._root = parser._parse_whole(source)
File "/usr/lib/python3.9/gzip.py", line 300, in read
return self._buffer.read(size)
File "/usr/lib/python3.9/_compression.py", line 68, in readinto
data = self.read(len(byte_view))
File "/usr/lib/python3.9/gzip.py", line 487, in read
if not self._read_gzip_header():
File "/usr/lib/python3.9/gzip.py", line 435, in _read_gzip_header
raise BadGzipFile('Not a gzipped file (%r)' % magic)
gzip.BadGzipFile: Not a gzipped file (b'er')
|
|||
| pypath.inputs.phosphosite.phosphosite_interactions_curated | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 1093, in phosphosite_interactions_curated
curated, noref = phosphosite_interactions(ncbi_tax_id = ncbi_tax_id)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 679, in phosphosite_interactions
xml = ET.parse(bpax)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 1229, in parse
tree.parse(source, parser)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 580, in parse
self._root = parser._parse_whole(source)
File "/usr/lib/python3.9/gzip.py", line 300, in read
return self._buffer.read(size)
File "/usr/lib/python3.9/_compression.py", line 68, in readinto
data = self.read(len(byte_view))
File "/usr/lib/python3.9/gzip.py", line 487, in read
if not self._read_gzip_header():
File "/usr/lib/python3.9/gzip.py", line 435, in _read_gzip_header
raise BadGzipFile('Not a gzipped file (%r)' % magic)
gzip.BadGzipFile: Not a gzipped file (b'er')
|
|||
| pypath.inputs.phosphosite.phosphosite_interactions_new | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 948, in phosphosite_interactions_new
xml = ET.parse(bpax)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 1229, in parse
tree.parse(source, parser)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 580, in parse
self._root = parser._parse_whole(source)
File "/usr/lib/python3.9/gzip.py", line 300, in read
return self._buffer.read(size)
File "/usr/lib/python3.9/_compression.py", line 68, in readinto
data = self.read(len(byte_view))
File "/usr/lib/python3.9/gzip.py", line 487, in read
if not self._read_gzip_header():
File "/usr/lib/python3.9/gzip.py", line 435, in _read_gzip_header
raise BadGzipFile('Not a gzipped file (%r)' % magic)
gzip.BadGzipFile: Not a gzipped file (b'er')
|
|||
| pypath.inputs.phosphosite.phosphosite_interactions_noref | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 1110, in phosphosite_interactions_noref
curated, noref = phosphosite_interactions(ncbi_tax_id = ncbi_tax_id)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 679, in phosphosite_interactions
xml = ET.parse(bpax)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 1229, in parse
tree.parse(source, parser)
File "/usr/lib/python3.9/xml/etree/ElementTree.py", line 580, in parse
self._root = parser._parse_whole(source)
File "/usr/lib/python3.9/gzip.py", line 300, in read
return self._buffer.read(size)
File "/usr/lib/python3.9/_compression.py", line 68, in readinto
data = self.read(len(byte_view))
File "/usr/lib/python3.9/gzip.py", line 487, in read
if not self._read_gzip_header():
File "/usr/lib/python3.9/gzip.py", line 435, in _read_gzip_header
raise BadGzipFile('Not a gzipped file (%r)' % magic)
gzip.BadGzipFile: Not a gzipped file (b'er')
|
|||
| pypath.inputs.phosphosite.phosphosite_ptm_orthology | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 209, in phosphosite_ptm_orthology
for typ in common.psite_mod_types:
NameError: name 'common' is not defined
|
|||
| pypath.inputs.phosphosite.phosphosite_ptms | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 289, in phosphosite_ptms
for _ in xrange(4):
NameError: name 'xrange' is not defined
|
|||
| pypath.inputs.phosphosite.phosphosite_regsites | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 372, in phosphosite_regsites
data = inputs_common.read_table(
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 228, in read_table
_ = next(fileObject)
TypeError: 'NoneType' object is not an iterator
|
|||
| pypath.inputs.phosphosite.phosphosite_regsites_one_organism | 2021-09-10 18:12:54 | 2021-09-10 18:12:54 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/phosphosite.py", line 477, in phosphosite_regsites_one_organism
mod_types = dict(common.psite_mod_types2)
NameError: name 'common' is not defined
|
|||
| pypath.inputs.phosphosite.regsites_tab |
Not calling `pypath.inputs.phosphosite.regsites_tab`, not enough arguments. |
||||||
| pypath.inputs.pisa.pisa_bonds |
Not calling `pypath.inputs.pisa.pisa_bonds`, not enough arguments. |
||||||
| pypath.inputs.pisa.pisa_interfaces |
Not calling `pypath.inputs.pisa.pisa_interfaces`, not enough arguments. |
||||||
| pypath.inputs.pro.get_pro | 2021-09-10 18:12:54 | 2021-09-10 18:13:13 | 19.0 | Obo | <OBO file `https://proconsortium.org/download/current/pro_reasoned.obo`> | None | |
| pypath.inputs.pro.pro_mapping | 2021-09-10 18:13:13 | 2021-09-10 18:13:16 | 3.0 | list | [('PR:000000005', 'P37173'), ('PR:000000005', 'P38438'), ('PR:000000005', 'Q62312'), ('PR:000000005', 'Q90999'), ('PR:000000007', 'A0A0G2KN81'), ('PR:000000009', 'Q16671'), ('PR:000000009', 'Q62893'), ('PR:000000009', 'Q8K592'), ('PR:000000010', 'O57472'), ('PR:000000010', 'Q24025'), ('PR:000000010'...(truncated) | 315,413 | |
| pypath.inputs.proteinatlas.get_proteinatlas | 2021-09-10 18:13:16 | 2021-09-10 18:14:14 | 58.0 | dict | {'normal': defaultdict(<class 'dict'>, {'adipose tissue:adipocytes': {'O43657': ('Not detected', 'Approved'), 'O60762': ('Medium', 'Approved'), 'Q8IZE3': ('Low', 'Approved'), 'Q9NSG2': ('Medium', 'Uncertain'), 'P09769': ('Not detected', 'Enhanced'), 'P08603': ('Not detected', 'Supported'), 'Q9BTY2':...(truncated) | 2 | |
| pypath.inputs.proteinatlas.proteinatlas_annotations | 2021-09-10 18:14:15 | 2021-09-10 18:16:02 | 107.0 | defaultdict | defaultdict(<class 'set'>, {'O43657': {ProtainatlasAnnotation(organ='liver', tissue='cholangiocytes', level='Medium', status='Approved', n_not_detected=None, n_low=None, n_medium=None, n_high=None, prognostic=False, favourable=False, score=None, pathology=False), ProtainatlasAnnotation(organ='append...(truncated) | 19,095 | |
| pypath.inputs.proteinatlas.proteinatlas_secretome_annotations | 2021-09-10 18:16:04 | 2021-09-10 18:16:04 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/proteinatlas.py", line 254, in proteinatlas_secretome_annotations
reader = inputs_common.read_xls(c.fileobj.name)[1:]
AttributeError: 'Curl' object has no attribute 'fileobj'
|
|||
| pypath.inputs.proteinatlas.proteinatlas_subcellular_annotations | 2021-09-10 18:16:04 | 2021-09-10 18:16:05 | 1.0 | dict | {'Q8IZE3': {ProteinatlasSubcellularAnnotation(location='Nuclear bodies', status='Uncertain'), ProteinatlasSubcellularAnnotation(location='Microtubules', status='Uncertain')}, 'P23511': {ProteinatlasSubcellularAnnotation(location='Nucleoplasm', status='Supported')}, 'Q9Y4W2': {ProteinatlasSubcellular...(truncated) | 6,634 | |
| pypath.inputs.protmapper.get_protmapper | 2021-09-10 18:16:05 | 2021-09-10 18:16:10 | 5.0 | tuple | ([{'ID': '0', 'CTRL_NS': 'UP', 'CTRL_ID': 'Q02156', 'CTRL_GENE_NAME': 'PRKCE', 'CTRL_IS_KINASE': 'True', 'TARGET_UP_ID': 'P15336', 'TARGET_GENE_NAME': 'ATF2', 'TARGET_RES': 'T', 'TARGET_POS': '52', 'SOURCES': 'psp,reach,signor,sparser'}, {'ID': '1', 'CTRL_NS': 'FPLX', 'CTRL_ID': 'PKC', 'CTRL_GENE_NA...(truncated) | 2 | |
| pypath.inputs.protmapper.protmapper_enzyme_substrate | 2021-09-10 18:16:10 | 2021-09-10 18:16:11 | 1.0 | list | [{'kinase': 'Q02156', 'resaa': 'T', 'resnum': 52, 'references': {'22304920', '25728676', '24357804', '25545367', '24727247'}, 'substrate': 'P15336', 'databases': {'SIGNOR', 'PhosphoSite', 'Sparser', 'REACH'}}, {'kinase': 'Q02156', 'resaa': 'T', 'resnum': 280, 'references': {'23708658', '24727247'}, ...(truncated) | 22,139 | |
| pypath.inputs.protmapper.protmapper_interactions |
Not calling `pypath.inputs.protmapper.protmapper_interactions`, not enough arguments. |
||||||
| pypath.inputs.pubmed.get_pmid |
Not calling `pypath.inputs.pubmed.get_pmid`, not enough arguments. |
||||||
| pypath.inputs.pubmed.get_pubmeds |
Not calling `pypath.inputs.pubmed.get_pubmeds`, not enough arguments. |
||||||
| pypath.inputs.pubmed.only_pmids |
Not calling `pypath.inputs.pubmed.only_pmids`, not enough arguments. |
||||||
| pypath.inputs.pubmed.open_pubmed |
Not calling `pypath.inputs.pubmed.open_pubmed`, not enough arguments. |
||||||
| pypath.inputs.pubmed.pmids_dict |
Not calling `pypath.inputs.pubmed.pmids_dict`, not enough arguments. |
||||||
| pypath.inputs.pubmed.pmids_list |
Not calling `pypath.inputs.pubmed.pmids_list`, not enough arguments. |
||||||
| pypath.inputs.ramilowski2015.ramilowski_interactions | 2021-09-10 18:16:11 | 2021-09-10 18:16:11 | 0.0 | list | [['A2M', 'LRP1', '', 'HPMR;HPRD;STRING.binding;STRING.experiment;literature supported'], ['AANAT', 'MTNR1A', '', 'HPMR;literature supported'], ['AANAT', 'MTNR1B', '', 'HPMR;literature supported'], ['ACE', 'AGTR2', '', 'HPRD;literature supported'], ['ACE', 'BDKRB2', '', 'HPRD;literature supported'], ...(truncated) | 1,894 | |
| pypath.inputs.ramilowski2015.ramilowski_locations | 2021-09-10 18:16:11 | 2021-09-10 18:16:18 | 7.0 | defaultdict | defaultdict(<class 'set'>, {'P04217': {RamilowskiLocation(location='secreted', source='UniProt', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='Consensus6', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='LocTree3', tmh=0, note=N...(truncated) | 18,872 | |
| pypath.inputs.rdata._patch_rdata | 2021-09-10 18:16:18 | 2021-09-10 18:16:18 | 0.0 | NoneType | None | None | |
| pypath.inputs.rdata._rdata_data_frame_get_rownames |
Not calling `pypath.inputs.rdata._rdata_data_frame_get_rownames`, not enough arguments. |
||||||
| pypath.inputs.rdata._rdata_list_get_names |
Not calling `pypath.inputs.rdata._rdata_list_get_names`, not enough arguments. |
||||||
| pypath.inputs.reaction._bp_collect_resources |
Not calling `pypath.inputs.reaction._bp_collect_resources`, not enough arguments. |
||||||
| pypath.inputs.reaction._process_controls |
Not calling `pypath.inputs.reaction._process_controls`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_collect_resources |
Not calling `pypath.inputs.reaction._reactome_collect_resources`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_collect_species |
Not calling `pypath.inputs.reaction._reactome_collect_species`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_compartment |
Not calling `pypath.inputs.reaction._reactome_compartment`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_extract_id |
Not calling `pypath.inputs.reaction._reactome_extract_id`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_extract_res |
Not calling `pypath.inputs.reaction._reactome_extract_res`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_id |
Not calling `pypath.inputs.reaction._reactome_id`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_reaction |
Not calling `pypath.inputs.reaction._reactome_reaction`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_reactions | 2021-09-10 18:16:18 | 2021-09-10 18:16:21 | 3.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 953, in _reactome_reactions
soup = reactome_bs()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 132, in reactome_bs
soup = bs4.BeautifulSoup(sbml.read(), 'html.parser')
AttributeError: 'NoneType' object has no attribute 'read'
|
|||
| pypath.inputs.reaction._reactome_reactions_et | 2021-09-10 18:16:21 | 2021-09-10 18:16:21 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 1011, in _reactome_reactions_et
ctx = etree.iterparse(sbmlfile, events = ('end', ))
File "src/lxml/iterparse.pxi", line 78, in lxml.etree.iterparse.__init__
TypeError: expected str, bytes or os.PathLike object, not generator
|
|||
| pypath.inputs.reaction._reactome_res |
Not calling `pypath.inputs.reaction._reactome_res`, not enough arguments. |
||||||
| pypath.inputs.reaction._reactome_species |
Not calling `pypath.inputs.reaction._reactome_species`, not enough arguments. |
||||||
| pypath.inputs.reaction.acsn_biopax | 2021-09-10 18:16:21 | 2021-09-10 18:16:22 | 1.0 | generator | <generator object FileOpener.iterfile at 0x7fdaa7487f90> | None | |
| pypath.inputs.reaction.acsn_interactions_2 |
Not calling `pypath.inputs.reaction.acsn_interactions_2`, not enough arguments. |
||||||
| pypath.inputs.reaction.get_acsn_effects | 2021-09-10 18:16:22 | 2021-09-10 18:16:22 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 1115, in get_acsn_effects
data = acsn_interactions()
NameError: name 'acsn_interactions' is not defined
|
|||
| pypath.inputs.reaction.get_controls |
Not calling `pypath.inputs.reaction.get_controls`, not enough arguments. |
||||||
| pypath.inputs.reaction.get_interactions |
Not calling `pypath.inputs.reaction.get_interactions`, not enough arguments. |
||||||
| pypath.inputs.reaction.get_reactions | 2021-09-10 18:16:22 | 2021-09-10 18:16:22 | 0.0 | generator | <generator object get_reactions at 0x7fdaa7487f90> | None | |
| pypath.inputs.reaction.get_soup |
Not calling `pypath.inputs.reaction.get_soup`, not enough arguments. |
||||||
| pypath.inputs.reaction.panther_biopax | 2021-09-10 18:16:22 | 2021-09-10 18:19:06 | 164.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 118, in panther_biopax
c = curl.Curl(url, silent = False, large = True).values()
AttributeError: 'Curl' object has no attribute 'values'
|
|||
| pypath.inputs.reaction.panther_interactions |
Not calling `pypath.inputs.reaction.panther_interactions`, not enough arguments. |
||||||
| pypath.inputs.reaction.pid_biopax | 2021-09-10 18:19:06 | 2021-09-10 18:19:08 | 2.0 | NoneType | None | None | |
| pypath.inputs.reaction.pid_interactions |
Not calling `pypath.inputs.reaction.pid_interactions`, not enough arguments. |
||||||
| pypath.inputs.reaction.process_complex |
Not calling `pypath.inputs.reaction.process_complex`, not enough arguments. |
||||||
| pypath.inputs.reaction.process_controls |
Not calling `pypath.inputs.reaction.process_controls`, not enough arguments. |
||||||
| pypath.inputs.reaction.process_reactions |
Not calling `pypath.inputs.reaction.process_reactions`, not enough arguments. |
||||||
| pypath.inputs.reaction.reactions_biopax |
Not calling `pypath.inputs.reaction.reactions_biopax`, not enough arguments. |
||||||
| pypath.inputs.reaction.reactome_biopax | 2021-09-10 18:19:08 | 2021-09-10 18:19:08 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 73, in reactome_biopax
cache.get_cachedir(),
AttributeError: 'bool' object has no attribute 'get_cachedir'
|
|||
| pypath.inputs.reaction.reactome_bs | 2021-09-10 18:19:08 | 2021-09-10 18:19:08 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/reaction.py", line 132, in reactome_bs
soup = bs4.BeautifulSoup(sbml.read(), 'html.parser')
AttributeError: 'generator' object has no attribute 'read'
|
|||
| pypath.inputs.reaction.reactome_interactions |
Not calling `pypath.inputs.reaction.reactome_interactions`, not enough arguments. |
||||||
| pypath.inputs.reaction.reactome_sbml | 2021-09-10 18:19:08 | 2021-09-10 18:19:08 | 0.0 | generator | <generator object FileOpener.iterfile at 0x7fdacdb116d0> | None | |
| pypath.inputs.signalink.signalink_annotations | 2021-09-10 18:19:08 | 2021-09-10 18:19:10 | 2.0 | dict | {'pathway': defaultdict(<class 'set'>, {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Toll-like receptor'), SignalinkPathway(pathway='Innate ...(truncated) | 2 | |
| pypath.inputs.signalink.signalink_function_annotations | 2021-09-10 18:19:10 | 2021-09-10 18:19:11 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'P43403': {SignalinkFunction(function='Scaffold'), SignalinkFunction(function='Mediator')}, 'Q9NYJ8': {SignalinkFunction(function='Co-factor'), SignalinkFunction(function='Scaffold')}, 'O43318': {SignalinkFunction(function='Mediator')}, 'P15018': {SignalinkFunction(functi...(truncated) | 784 | |
| pypath.inputs.signalink.signalink_interactions | 2021-09-10 18:19:11 | 2021-09-10 18:19:11 | 0.0 | list | [SignalinkInteraction(id_a='P20963', id_b='P43403', is_direct=True, is_directed=True, effect=0, pathways_a=['T-cell receptor'], pathways_b=['Receptor tyrosine kinase', 'T-cell receptor'], functions_a=[], functions_b=['Mediator', 'Scaffold'], references=['10358158', '10358164', '10562324', '10925299'...(truncated) | 1,939 | |
| pypath.inputs.signalink.signalink_pathway_annotations | 2021-09-10 18:19:11 | 2021-09-10 18:19:12 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Toll-like receptor'), SignalinkPathway(pathway='Innate immune pathw...(truncated) | 836 | |
| pypath.inputs.signor.signor_complexes | 2021-09-10 18:19:12 | 2021-09-10 18:19:12 | 0.0 | dict | {'COMPLEX:P23511_P25208_Q13952': Complex NFY: COMPLEX:P23511_P25208_Q13952, 'COMPLEX:P68104_P85299_Q6R327_Q8TB45_Q9BVC4': Complex mTORC2: COMPLEX:P68104_P85299_Q6R327_Q8TB45_Q9BVC4, 'COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4': Complex mTORC1: COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4, 'COMPLEX:P63...(truncated) | 2,975 | |
| pypath.inputs.signor.signor_enzyme_substrate | 2021-09-10 18:19:12 | 2021-09-10 18:19:15 | 3.0 | list | [{'typ': 'phosphorylation', 'resnum': 772, 'instance': 'EDDPEATYTTSGGKI', 'substrate': 'P29317', 'start': 765, 'end': 779, 'kinase': 'P29317', 'resaa': 'Y', 'motif': 'EDDPEATYTTSGGKI', 'enzyme_isoform': None, 'substrate_isoform': None, 'references': {'18387945'}}, {'typ': 'phosphorylation', 'resnum'...(truncated) | 9,839 | |
| pypath.inputs.signor.signor_interactions | 2021-09-10 18:19:15 | 2021-09-10 18:19:16 | 1.0 | list | [SignorInteraction(source='P29317', target='P29317', source_isoform=None, target_isoform=None, source_type='protein', target_type='protein', effect='up-regulates', mechanism='phosphorylation', ncbi_tax_id='9606', pubmeds='18387945', direct=True, ptm_type='phosphorylation', ptm_residue='Tyr772', ptm_...(truncated) | 30,487 | |
| pypath.inputs.signor.signor_pathway_annotations | 2021-09-10 18:19:16 | 2021-09-10 18:19:36 | 20.0 | defaultdict | defaultdict(<class 'set'>, {'Q8N726': {SignorPathway(pathway='Acute Myeloid Leukemia'), SignorPathway(pathway='Cell cycle: G2/M phase transition'), SignorPathway(pathway='Cell cycle: G1/S phase transition')}, 'P29375': {SignorPathway(pathway='Acute Myeloid Leukemia')}, 'Q76L83': {SignorPathway(pathw...(truncated) | 547 | |
| pypath.inputs.signor.signor_pathways |
Not calling `pypath.inputs.signor.signor_pathways`, not enough arguments. |
||||||
| pypath.inputs.signor.signor_protein_families | 2021-09-10 18:19:36 | 2021-09-10 18:19:36 | 0.0 | dict | {'SIGNOR-PF1': ['P28482', 'P27361'], 'SIGNOR-PF2': ['Q9HBW0', 'Q9UBY5', 'Q92633'], 'SIGNOR-PF3': ['O14610', 'O60262', 'Q9P2W3', 'P63215', 'P63211', 'P50150', 'P59768', 'P63218', 'P61952', 'Q9UK08', 'Q9UBI6', 'P50151'], 'SIGNOR-PF4': ['P28482', 'P27361'], 'SIGNOR-PF5': ['P01137', 'P10600', 'P61812'],...(truncated) | 67 | |
| pypath.inputs.spike.spike_interactions | 2021-09-10 18:19:36 | 2021-09-10 18:19:49 | 13.0 | list | [['836', 'CASP3', '8669', 'EIF3J', '1', '10672017', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['836', 'CASP3', '3691', 'ITGB4', '1', '17178732', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['407042', 'MIR34C', '4609', 'MYC', '1', '20212154', '1', '2', ...(truncated) | 3,842 | |
| pypath.inputs.stitch.stitch_interactions | 2021-09-10 18:19:49 | 2021-09-10 18:19:49 | 0.0 | generator | <generator object stitch_interactions at 0x7fdaee545350> | None | |
| pypath.inputs.string.string_effects | 2021-09-10 18:19:49 | 2021-09-10 18:19:58 | 9.0 | list | [StringInteraction(source='ENSP00000216366', target='ENSP00000000233', effect='*'), StringInteraction(source='ENSP00000000233', target='ENSP00000216366', effect='*'), StringInteraction(source='ENSP00000222547', target='ENSP00000000233', effect='*'), StringInteraction(source='ENSP00000000233', target...(truncated) | 2,250,122 | |
| pypath.inputs.surfaceome.surfaceome_annotations | 2021-09-10 18:19:59 | 2021-09-10 18:20:03 | 4.0 | dict | {'A0AV02': (0.8363, 'Transporters', {'APC', 'SLC', 'SLC12'}), 'A0FGR9': (0.0465, 'Unclassified', {'Unclassified'}), 'A0PJK1': (0.8802, 'Transporters', {'APC', 'SLC', 'SLC5'}), 'A0PK11': (0.6108, 'Unclassified', {'Unclassified'}), 'A0ZSE6': (0.6327, 'Miscellaneous', {'Unknown_function', 'TMEM30'}), '...(truncated) | 2,809 | |
| pypath.inputs.switches_elm.get_switches_elm | 2021-09-10 18:20:03 | 2021-09-10 18:20:03 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/switches_elm.py", line 48, in get_switches_elm
url = data.formats.urls['switches.elm']['url']
UnboundLocalError: local variable 'data' referenced before assignment
|
|||
| pypath.inputs.talklr.talklr_annotations | 2021-09-10 18:20:03 | 2021-09-10 18:20:04 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'P01023': {TalklrAnnotation(role='ligand', pmid=None, putative=False)}, 'Q07954': {TalklrAnnotation(role='receptor', pmid='21054788', putative=False), TalklrAnnotation(role='receptor', pmid=None, putative=False), TalklrAnnotation(role='receptor', pmid='11560994', putative...(truncated) | 1,346 | |
| pypath.inputs.talklr.talklr_interactions | 2021-09-10 18:20:04 | 2021-09-10 18:20:04 | 0.0 | generator | <generator object talklr_interactions at 0x7fdace2d3820> | None | |
| pypath.inputs.talklr.talklr_raw | 2021-09-10 18:20:04 | 2021-09-10 18:20:04 | 0.0 | DataFrame | Pair_Name Ligand_ApprovedSymbol ... Pair_Source Pair_Evidence 0 A2M_LRP1 A2M ... known literature supported 1 AANAT_MTNR1A AANAT ... known literature supported 2 AANAT_MTNR1B AANAT ... known l...(truncated) | 2,422 | |
| pypath.inputs.tcdb.tcdb_annotations | 2021-09-10 18:20:04 | 2021-09-10 18:20:07 | 3.0 | defaultdict | defaultdict(<class 'set'>, {'P60201': {TcdbAnnotation(family='Myelin Proteolipid Protein (MPLP)', tcid='9.B.38.1.2')}, 'Q9NWF4': {TcdbAnnotation(family='Eukaryotic Riboflavin Transporter (E-RFT)', tcid='2.A.125.1.1')}, 'O00161': {TcdbAnnotation(family='Synaptosomal Vesicle Fusion Pore (SVF-Pore)', t...(truncated) | 2,003 | |
| pypath.inputs.tcdb.tcdb_classes | 2021-09-10 18:20:07 | 2021-09-10 18:20:07 | 0.0 | dict | {'A0CIB0': ('1.A.17.1.13', '1.A.17'), 'A0CS82': ('9.B.82.1.5', '9.B.82'), 'A0CX44': ('1.A.3.2.4', '1.A.3'), 'A0D5K0': ('2.A.66.3.4', '2.A.66'), 'A0E9B5': ('9.B.38.2.1', '9.B.38'), 'A0ECD9': ('3.A.1.207.1', '3.A.1'), 'A0FKN5': ('2.A.53.2.9', '2.A.53'), 'A0JCJ5': ('1.B.1.1.7', '1.B.1'), 'A0JSP2': ('3....(truncated) | 21,465 | |
| pypath.inputs.tcdb.tcdb_families | 2021-09-10 18:20:07 | 2021-09-10 18:20:07 | 0.0 | dict | {'1.A.1': 'Voltage-gated Ion Channel (VIC)', '1.A.10': 'Glutamate-gated Ion Channel (GIC) of Neurotransmitter Receptors', '1.A.100': 'Rhabdoviridae Putative Viroporin, U5 (RV-U5)', '1.A.101': 'Peroxisomal Pore-forming Pex11 (Pex11)', '1.A.102': 'Influenza A viroporin PB1-F2 (PB1-F2)', '1.A.103': 'Si...(truncated) | 1,624 | |
| pypath.inputs.tfcensus.tfcensus_annotations | 2021-09-10 18:20:07 | 2021-09-10 18:21:22 | 75.0 | dict | {'P23511': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'Q96QS3': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P31270': {TfcensusAnnotation(tfcensus_class='a', tissue='uterus')}, 'P57073': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P17010': {TfcensusAnnotation(tfcen...(truncated) | 1,886 | |
| pypath.inputs.threedcomplex.threedcomplex_chains | 2021-09-10 18:21:22 | 2021-09-10 18:21:28 | 6.0 | dict | {'code': {'ch_new': 'ch_old'}, '4b5m_1': {'L': 'L', 'A': 'A', 'V': 'V', 'U': 'U'}, '4b5m_2': {'W': 'W', 'M': 'M', 'B': 'B', 'X': 'X'}, '4b5m_3': {'N': 'N', 'Z': 'Z', 'C': 'C', 'Y': 'Y'}, '4abk_1': {'A': 'A'}, '1lsz_1': {'A': 'A'}, '3gll_1': {'C': 'A', 'A': 'A', 'B': 'A'}, '1hz6_4': {'C': 'C', 'A': '...(truncated) | 174,325 | |
| pypath.inputs.threedcomplex.threedcomplex_complexes | 2021-09-10 18:21:29 | 2021-09-10 18:21:29 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedcomplex.py", line 42, in threedcomplex_complexes
raise NotImplementedError
NotImplementedError
|
|||
| pypath.inputs.threedcomplex.threedcomplex_contacts | 2021-09-10 18:21:29 | 2021-09-10 18:22:05 | 36.0 | set | {ThreedcomplexContact(pdb='5k4h_1', uniprot_1='P50286', uniprot_2='P50286', chain_1='B', chain_2='D', n_residues=13.5, length_1=320, length_2=319, domain_s1=('',), domain_p1=('PF00710.15',), domain_s2=('',), domain_p2=('PF00710.15',), ident=True, homo=True), ThreedcomplexContact(pdb='1jgc_1', unipro...(truncated) | 260,286 | |
| pypath.inputs.threedcomplex.threedcomplex_ddi | 2021-09-10 18:22:06 | 2021-09-10 18:28:49 | 403.0 | list | [<pypath.internals.intera.DomainDomain object at 0x7fdaa2a1ca00>, <pypath.internals.intera.DomainDomain object at 0x7fdaa2a1c9d0>, <pypath.internals.intera.DomainDomain object at 0x7fdad63fd1f0>, <pypath.internals.intera.DomainDomain object at 0x7fda6c1ded60>, <pypath.internals.intera.DomainDomain o...(truncated) | 525,728 | |
| pypath.inputs.threedcomplex.threedcomplex_nresidues | 2021-09-10 18:28:50 | 2021-09-10 18:28:50 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedcomplex.py", line 275, in threedcomplex_nresidues
for contact in contacts:
NameError: name 'contacts' is not defined
|
|||
| pypath.inputs.threedid.get_3did | 2021-09-10 18:28:50 | 2021-09-10 18:28:50 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedid.py", line 171, in get_3did
resultfile = os.path.join(settings.get('cachedir'), '3did_ddi.pickle')
NameError: name 'os' is not defined
|
|||
| pypath.inputs.threedid.get_3did_ddi | 2021-09-10 18:28:50 | 2021-09-10 18:28:58 | 8.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedid.py", line 45, in get_3did_ddi
u_pfam, pfam_u = pfam_input.pfam_uniprot(organism = organism)
NameError: name 'pfam_input' is not defined
|
|||
| pypath.inputs.threedid.get_3did_dmi | 2021-09-10 18:28:58 | 2021-09-10 18:28:58 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedid.py", line 320, in get_3did_dmi
resultfile = os.path.join(settings.get('cachedir'), '3did_dmi.pickle')
NameError: name 'os' is not defined
|
|||
| pypath.inputs.threedid.process_3did_dmi | 2021-09-10 18:28:58 | 2021-09-10 18:28:58 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedid.py", line 428, in process_3did_dmi
dmi = get_3did_dmi()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/threedid.py", line 320, in get_3did_dmi
resultfile = os.path.join(settings.get('cachedir'), '3did_dmi.pickle')
NameError: name 'os' is not defined
|
|||
| pypath.inputs.topdb.topdb_annotations | 2021-09-10 18:28:58 | 2021-09-10 18:29:04 | 6.0 | defaultdict | defaultdict(<class 'set'>, {'P05067': {TopdbAnnotation(membrane='Cytoplasm', topology='Inside', score=89, tmregions=1), TopdbAnnotation(membrane='Extracellular', topology='Signal', score=89, tmregions=1), TopdbAnnotation(membrane='Cytoplasm', topology='Signal', score=89, tmregions=1), TopdbAnnotatio...(truncated) | 1,248 | |
| pypath.inputs.transmir.transmir_interactions | 2021-09-10 18:29:04 | 2021-09-10 18:29:06 | 2.0 | list | [TransmirInteraction(tf_genesymbol='AGO2', mirna='hsa-mir-155', effect='Repression', pubmed='24263100'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-106b', effect='Activation', pubmed='24798859'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-132', effect='Activation', pubmed='...(truncated) | 2,678 | |
| pypath.inputs.trip.take_a_trip | 2021-09-10 18:29:06 | 2021-09-10 18:29:56 | 50.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 78, in take_a_trip
mainsoup = bs4.BeautifulSoup(mainhtml, 'html.parser')
File "/usr/lib/python3/dist-packages/bs4/__init__.py", line 287, in __init__
elif len(markup) <= 256 and (
TypeError: object of type 'NoneType' has no len()
|
|||
| pypath.inputs.trip.trip_find_uniprot |
Not calling `pypath.inputs.trip.trip_find_uniprot`, not enough arguments. |
||||||
| pypath.inputs.trip.trip_get_uniprot |
Not calling `pypath.inputs.trip.trip_get_uniprot`, not enough arguments. |
||||||
| pypath.inputs.trip.trip_interactions | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 297, in trip_interactions
data = trip_process(exclude_methods, predictions, species, strict)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 210, in trip_process
data = take_a_trip()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 81, in take_a_trip
for ul in mainsoup.find(
AttributeError: 'NoneType' object has no attribute 'find'
|
|||
| pypath.inputs.trip.trip_process | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 210, in trip_process
data = take_a_trip()
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/trip.py", line 81, in take_a_trip
for ul in mainsoup.find(
AttributeError: 'NoneType' object has no attribute 'find'
|
|||
| pypath.inputs.trip.trip_process_table |
Not calling `pypath.inputs.trip.trip_process_table`, not enough arguments. |
||||||
| pypath.inputs.unichem.info |
Not calling `pypath.inputs.unichem.info`, not enough arguments. |
||||||
| pypath.inputs.unichem.unichem_info | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | list | [UnichemSource(number='1', label='chembl', name='ChEMBL', description='A database of bioactive drug-like small molecules and bioactivities abstracted from the scientific literature.', acquisition='Standard InChIs and Keys provided on ftp site for each release.'), UnichemSource(number='2', label='dru...(truncated) | 41 | |
| pypath.inputs.unichem.unichem_mapping |
Not calling `pypath.inputs.unichem.unichem_mapping`, not enough arguments. |
||||||
| pypath.inputs.unichem.unichem_sources | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | dict | {'1': 'chembl', '2': 'drugbank', '3': 'pdb', '4': 'gtopdb', '5': 'pubchem_dotf', '6': 'kegg_ligand', '7': 'chebi', '8': 'nih_ncc', '9': 'zinc', '10': 'emolecules', '11': 'ibm', '12': 'atlas', '14': 'fdasrs', '15': 'surechembl', '17': 'pharmgkb', '18': 'hmdb', '20': 'selleck', '21': 'pubchem_tpharma'...(truncated) | 41 | |
| pypath.inputs.uniprot._all_uniprots | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | set | {'B7Z661', 'A0A5C2GKP8', 'A0A678ZGH7', 'G9LEG2', 'A0A7P0TAV2', 'F8W6L0', 'A0A2U7MZJ5', 'Q8TDU5', 'A0A0R6N9S2', 'O60635', 'K7EQJ5', 'B3KSM5', 'H0Y7K3', 'A0A6I8PRE0', 'H3BPQ4', 'A0A5C2GRQ4', 'A0A3S6RJ05', 'B8ZZS6', 'A0A343E084', 'A0A494C0V0', 'H3BMA8', 'H0YC67', 'Q8TAS0', 'H0YMR9', 'Q9NYY7', 'H3BPR8',...(truncated) | 202,160 | |
| pypath.inputs.uniprot._cleanup | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | NoneType | None | None | |
| pypath.inputs.uniprot._protein_datasheet |
Not calling `pypath.inputs.uniprot._protein_datasheet`, not enough arguments. |
||||||
| pypath.inputs.uniprot._remove |
Not calling `pypath.inputs.uniprot._remove`, not enough arguments. |
||||||
| pypath.inputs.uniprot._swissprot_param |
Not calling `pypath.inputs.uniprot._swissprot_param`, not enough arguments. |
||||||
| pypath.inputs.uniprot._uniprot_deleted | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | set | {'MUP4', 'M3C9', 'NJ60', 'D2L5', 'NF02', 'Q7Y3', 'K1Q0', 'AME5', 'RP05', 'NIG7', 'RRT5', 'NIL8', 'NNG1', 'MU76', 'MXU9', 'QY13', 'MS94', 'NL58', 'NFJ7', 'NHY6', 'NLA2', 'KVV0', 'NMP4', 'W5P2', 'NLK3', 'RV21', 'MWS1', 'NCX1', 'NK39', 'RTT8', 'AV18', 'A620', 'NEA5', 'RTR2', 'NLN5', 'NDQ2', 'MPU0', 'RR...(truncated) | 262 | |
| pypath.inputs.uniprot.all_swissprots | 2021-09-10 18:29:56 | 2021-09-10 18:29:56 | 0.0 | set | {'Q8N815', 'Q15555', 'O43374', 'Q17RB8', 'Q8TDU5', 'O60635', 'Q8N6Q1', 'P0DMS8', 'P13631', 'B3EWG6', 'P35269', 'Q6UXP3', 'Q8NGT7', 'Q9H211', 'Q2T9K0', 'Q8NGG2', 'Q9Y4C4', 'O15151', 'P11274', 'Q14146', 'Q9Y3Q0', 'Q9H857', 'A0A0A0MS00', 'Q13685', 'Q9BZW5', 'Q5T5N4', 'Q8TF21', 'Q13470', 'Q7L8C5', 'Q9BV...(truncated) | 20,386 | |
| pypath.inputs.uniprot.all_trembls | 2021-09-10 18:29:56 | 2021-09-10 18:31:02 | 66.0 | set | {'B7Z661', 'A0A5C2GKP8', 'A0A678ZGH7', 'G9LEG2', 'A0A7P0TAV2', 'F8W6L0', 'A0A2U7MZJ5', 'A0A0R6N9S2', 'H0Y7K3', 'K7EQJ5', 'B3KSM5', 'A0A6I8PRE0', 'H3BPQ4', 'A0A5C2GRQ4', 'A0A3S6RJ05', 'B8ZZS6', 'A0A343E084', 'A0A494C0V0', 'H3BMA8', 'H0YC67', 'Q8TAS0', 'H0YMR9', 'Q9NYY7', 'H3BPR8', 'B3KWS6', 'Q2M3R2',...(truncated) | 181,774 | |
| pypath.inputs.uniprot.all_uniprots | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 | set | {'B7Z661', 'A0A5C2GKP8', 'A0A678ZGH7', 'G9LEG2', 'A0A7P0TAV2', 'F8W6L0', 'A0A2U7MZJ5', 'Q8TDU5', 'A0A0R6N9S2', 'O60635', 'K7EQJ5', 'B3KSM5', 'H0Y7K3', 'A0A6I8PRE0', 'H3BPQ4', 'A0A5C2GRQ4', 'A0A3S6RJ05', 'B8ZZS6', 'A0A343E084', 'A0A494C0V0', 'H3BMA8', 'H0YC67', 'Q8TAS0', 'H0YMR9', 'Q9NYY7', 'H3BPR8',...(truncated) | 202,160 | |
| pypath.inputs.uniprot.deleted_uniprot_genesymbol |
Not calling `pypath.inputs.uniprot.deleted_uniprot_genesymbol`, not enough arguments. |
||||||
| pypath.inputs.uniprot.get_db | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 | set | {'B7Z661', 'A0A5C2GKP8', 'A0A678ZGH7', 'G9LEG2', 'A0A7P0TAV2', 'F8W6L0', 'A0A2U7MZJ5', 'Q8TDU5', 'A0A0R6N9S2', 'O60635', 'K7EQJ5', 'B3KSM5', 'H0Y7K3', 'A0A6I8PRE0', 'H3BPQ4', 'A0A5C2GRQ4', 'A0A3S6RJ05', 'B8ZZS6', 'A0A343E084', 'A0A494C0V0', 'H3BMA8', 'H0YC67', 'Q8TAS0', 'H0YMR9', 'Q9NYY7', 'H3BPR8',...(truncated) | 202,160 | |
| pypath.inputs.uniprot.get_uniprot_sec | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 | generator | <generator object get_uniprot_sec at 0x7fdace6f9c80> | None | |
| pypath.inputs.uniprot.init_db | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 | NoneType | None | None | |
| pypath.inputs.uniprot.is_swissprot |
Not calling `pypath.inputs.uniprot.is_swissprot`, not enough arguments. |
||||||
| pypath.inputs.uniprot.is_trembl |
Not calling `pypath.inputs.uniprot.is_trembl`, not enough arguments. |
||||||
| pypath.inputs.uniprot.is_uniprot |
Not calling `pypath.inputs.uniprot.is_uniprot`, not enough arguments. |
||||||
| pypath.inputs.uniprot.protein_datasheet |
Not calling `pypath.inputs.uniprot.protein_datasheet`, not enough arguments. |
||||||
| pypath.inputs.uniprot.swissprot_deleted | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 | set | {'MUP4', 'M3C9', 'NJ60', 'D2L5', 'NF02', 'Q7Y3', 'K1Q0', 'AME5', 'RP05', 'NIG7', 'RRT5', 'NIL8', 'NNG1', 'MU76', 'MXU9', 'QY13', 'MS94', 'NL58', 'NFJ7', 'NHY6', 'NLA2', 'KVV0', 'NMP4', 'W5P2', 'NLK3', 'RV21', 'MWS1', 'NCX1', 'NK39', 'RTT8', 'AV18', 'A620', 'NEA5', 'RTR2', 'NLN5', 'NDQ2', 'MPU0', 'RR...(truncated) | 262 | |
| pypath.inputs.uniprot.trembl_deleted | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/uniprot.py", line 440, in trembl_deleted
return _uniprot_deleted(swissprot = False, confirm = True)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/uniprot.py", line 407, in _uniprot_deleted
resp = input(
OSError: [Errno 9] Bad file descriptor
|
|||
| pypath.inputs.uniprot.uniprot_data |
Not calling `pypath.inputs.uniprot.uniprot_data`, not enough arguments. |
||||||
| pypath.inputs.uniprot.uniprot_deleted | 2021-09-10 18:31:02 | 2021-09-10 18:31:02 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/uniprot.py", line 400, in uniprot_deleted
return swissprot_deleted() | trembl_deleted(confirm = confirm)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/uniprot.py", line 440, in trembl_deleted
return _uniprot_deleted(swissprot = False, confirm = True)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/uniprot.py", line 407, in _uniprot_deleted
resp = input(
OSError: [Errno 9] Bad file descriptor
|
|||
| pypath.inputs.uniprot.uniprot_families | 2021-09-10 18:31:02 | 2021-09-10 18:31:08 | 6.0 | defaultdict | defaultdict(<class 'set'>, {'Q00266': {UniprotFamily(family='AdoMet synthase', subfamily=None)}, 'Q8NB16': {UniprotFamily(family='Protein kinase', subfamily=None)}, 'O94851': {UniprotFamily(family='Mical', subfamily=None)}, 'Q8TDZ2': {UniprotFamily(family='Mical', subfamily=None)}, 'Q9NPJ6': {Unipro...(truncated) | 14,350 | |
| pypath.inputs.uniprot.uniprot_history |
Not calling `pypath.inputs.uniprot.uniprot_history`, not enough arguments. |
||||||
| pypath.inputs.uniprot.uniprot_history_recent_datasheet |
Not calling `pypath.inputs.uniprot.uniprot_history_recent_datasheet`, not enough arguments. |
||||||
| pypath.inputs.uniprot.uniprot_keywords | 2021-09-10 18:31:08 | 2021-09-10 18:31:31 | 23.0 | defaultdict | defaultdict(<class 'set'>, {'Q00266': {UniprotKeyword(keyword='3D-structure'), UniprotKeyword(keyword='Magnesium'), UniprotKeyword(keyword='Transferase'), UniprotKeyword(keyword='One-carbon metabolism'), UniprotKeyword(keyword='Potassium'), UniprotKeyword(keyword='Metal-binding'), UniprotKeyword(key...(truncated) | 20,386 | |
| pypath.inputs.uniprot.uniprot_locations | 2021-09-10 18:31:31 | 2021-09-10 18:31:39 | 8.0 | defaultdict | defaultdict(<class 'set'>, {'Q8NB16': {UniprotLocation(location='Nucleus', features=None), UniprotLocation(location='Cell membrane', features=None), UniprotLocation(location='Cytoplasm', features=None)}, 'O94851': {UniprotLocation(location='Nucleus', features=None)}, 'Q8TDZ2': {UniprotLocation(locat...(truncated) | 16,797 | |
| pypath.inputs.uniprot.uniprot_ncbi_taxids | 2021-09-10 18:31:39 | 2021-09-10 18:54:58 | 1,399.0 | dict | {1980042: Taxon(ncbi_id=1980042, latin='1,4-dioxane-degrading enrichment culture', english='', latin_synonym=None), 85621: Taxon(ncbi_id=85621, latin='16SrII (Peanut WB group)', english='', latin_synonym=None), 85623: Taxon(ncbi_id=85623, latin='16SrIII (X-disease group)', english='', latin_synonym=...(truncated) | 2,658,466 | |
| pypath.inputs.uniprot.uniprot_ncbi_taxids_2 | 2021-09-10 18:55:00 | 2021-09-10 18:55:00 | 0.0 | dict | {648330: Taxon(ncbi_id=648330, latin='Aedes albopictus densovirus (isolate Boublik/1994)', english='AalDNV', latin_synonym=None), 10804: Taxon(ncbi_id=10804, latin='Adeno-associated virus 2', english='AAV-2', latin_synonym=None), 648242: Taxon(ncbi_id=648242, latin='Adeno-associated virus 2 (isolate...(truncated) | 26,658 | |
| pypath.inputs.uniprot.uniprot_preprocess |
Not calling `pypath.inputs.uniprot.uniprot_preprocess`, not enough arguments. |
||||||
| pypath.inputs.uniprot.uniprot_recent_version |
Not calling `pypath.inputs.uniprot.uniprot_recent_version`, not enough arguments. |
||||||
| pypath.inputs.uniprot.uniprot_taxonomy | 2021-09-10 18:55:00 | 2021-09-10 18:55:03 | 3.0 | defaultdict | defaultdict(<class 'set'>, {'P00521': {'Abelson murine leukemia virus'}, 'P03333': {'Abelson murine leukemia virus'}, 'H8ZM73': {'Pinus balsamea', 'Balsam fir', 'Abies balsamea'}, 'H8ZM71': {'Pinus balsamea', 'Balsam fir', 'Abies balsamea'}, 'Q9MV51': {'Momi fir', 'Abies firma'}, 'O81086': {'Abies g...(truncated) | 551,169 | |
| pypath.inputs.uniprot.uniprot_tissues | 2021-09-10 18:55:03 | 2021-09-10 18:55:11 | 8.0 | defaultdict | defaultdict(<class 'set'>, {'Q00266': {UniprotTissue(tissue='Liver', level='undefined')}, 'Q8TDZ2': {UniprotTissue(tissue='Hematopoietic cells', level='undefined'), UniprotTissue(tissue='Thymus', level='undefined'), UniprotTissue(tissue='Testis', level='undefined'), UniprotTissue(tissue='Lung', leve...(truncated) | 9,891 | |
| pypath.inputs.uniprot.uniprot_topology | 2021-09-10 18:55:11 | 2021-09-10 18:56:22 | 71.0 | defaultdict | defaultdict(<class 'set'>, {'Q8NCK7': {UniprotTopology(topology='Transmembrane', start=106, end=126), UniprotTopology(topology='Transmembrane', start=333, end=353), UniprotTopology(topology='Transmembrane', start=163, end=183), UniprotTopology(topology='Transmembrane', start=273, end=293), UniprotTo...(truncated) | 5,212 | |
| pypath.inputs.uniprot.valid_uniprot |
Not calling `pypath.inputs.uniprot.valid_uniprot`, not enough arguments. |
||||||
| pypath.inputs.wang.get_hsn | 2021-09-10 18:56:22 | 2021-09-10 18:56:23 | 1.0 | list | [['1909', 'EDNRA', '4683', 'NBN', 'Pos'], ['7040', 'TGFB1', '7040', 'TGFB1', 'Neg'], ['9669', 'EIF5B', '6135', 'RPL11', 'Pos'], ['367', 'AR', '7337', 'UBE3A', 'Phy'], ['5291', 'PIK3CB', '57580', 'PREX1', 'Pos'], ['5568', 'PRKACG', '1499', 'CTNNB1', 'Pos'], ['156', 'ADRBK1', '155', 'ADRB3', 'Pos'], [...(truncated) | 62,937 | |
| pypath.inputs.wang.wang_interactions | 2021-09-10 18:56:23 | 2021-09-10 18:56:23 | 0.0 | list | [['EDNRA', 'NBN', '+'], ['TGFB1', 'TGFB1', '-'], ['EIF5B', 'RPL11', '+'], ['AR', 'UBE3A', '0'], ['PIK3CB', 'PREX1', '+'], ['PRKACG', 'CTNNB1', '+'], ['ADRBK1', 'ADRB3', '+'], ['ITGA2B', 'ACTN4', '0'], ['MCM7', 'UBE3A', '-'], ['CD4', 'ITK', '+'], ['STAT3', 'MYC', '+'], ['ZBTB17', 'NDRG2', '-'], ['CSN...(truncated) | 62,937 | |
| pypath.inputs.wojtowicz2020._id_translate |
Not calling `pypath.inputs.wojtowicz2020._id_translate`, not enough arguments. |
||||||
| pypath.inputs.wojtowicz2020.wojtowicz2020_interactions | 2021-09-10 18:56:23 | 2021-09-10 18:56:24 | 1.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 103, in read_xls
book = openpyxl.load_workbook(
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 315, in load_workbook
reader = ExcelReader(filename, read_only, keep_vba,
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 124, in __init__
self.archive = _validate_archive(fn)
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 96, in _validate_archive
archive = ZipFile(filename, 'r')
File "/usr/lib/python3.9/zipfile.py", line 1257, in __init__
self._RealGetContents()
File "/usr/lib/python3.9/zipfile.py", line 1324, in _RealGetContents
raise BadZipFile("File is not a zip file")
zipfile.BadZipFile: File is not a zip file
During handling of the above exception, another exception occurred:
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/wojtowicz2020.py", line 81, in wojtowicz2020_interactions
for rec in wojtowicz2020_raw():
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/wojtowicz2020.py", line 44, in wojtowicz2020_raw
content = inputs_common.read_xls(path)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 111, in read_xls
raise ValueError('Could not open xls: %s' % xls_file)
ValueError: Could not open xls: /home/omnipath/testing/pypath_inputs_status__20210910-161251/cache/9d0df0fb6df21b617036bed66b2693a1-mmc4.xlsx
|
|||
| pypath.inputs.wojtowicz2020.wojtowicz2020_raw | 2021-09-10 18:56:24 | 2021-09-10 18:56:24 | 0.0 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 103, in read_xls
book = openpyxl.load_workbook(
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 315, in load_workbook
reader = ExcelReader(filename, read_only, keep_vba,
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 124, in __init__
self.archive = _validate_archive(fn)
File "/usr/local/lib/python3.9/dist-packages/openpyxl/reader/excel.py", line 96, in _validate_archive
archive = ZipFile(filename, 'r')
File "/usr/lib/python3.9/zipfile.py", line 1257, in __init__
self._RealGetContents()
File "/usr/lib/python3.9/zipfile.py", line 1324, in _RealGetContents
raise BadZipFile("File is not a zip file")
zipfile.BadZipFile: File is not a zip file
During handling of the above exception, another exception occurred:
Traceback (most recent call last):
File "/home/omnipath/testing/./status-report.py", line 490, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/wojtowicz2020.py", line 44, in wojtowicz2020_raw
content = inputs_common.read_xls(path)
File "/home/omnipath/testing/pypath_inputs_status__20210910-161251/pypath/inputs/common.py", line 111, in read_xls
raise ValueError('Could not open xls: %s' % xls_file)
ValueError: Could not open xls: /home/omnipath/testing/pypath_inputs_status__20210910-161251/cache/9d0df0fb6df21b617036bed66b2693a1-mmc4.xlsx
|
|||
| pypath.inputs.zhong2015.zhong2015_annotations | 2021-09-10 18:56:24 | 2021-09-10 18:56:25 | 1.0 | defaultdict | defaultdict(<class 'set'>, {'P12830': {Zhong2015Annotation(type='iCAM')}, 'Q9Y6N8': {Zhong2015Annotation(type='iCAM')}, 'P55287': {Zhong2015Annotation(type='iCAM')}, 'P55290': {Zhong2015Annotation(type='iCAM')}, 'P55291': {Zhong2015Annotation(type='iCAM')}, 'O75309': {Zhong2015Annotation(type='iCAM'...(truncated) | 466 |
The OmniPath Team • Saez Lab • 2021-09-10