Here we take a snapshot from the current tip of the master branch of pypath, collect all functions from the pypath.inputs module and run them with an empty cache directory. Basic metrics about the returned values and errors are presented. This simple and automatized procedure is able to reveal the most common errors: if a server is down, if the URL, format or access restrictions changed, or pypath got broken in the recent developments. Note: this report is only about pypath, not about the data in the OmniPath web service; before we build the OmniPath database, we aim to fix the errors which could have an impact on its content.
Compiled between 2022-02-04 00:13:02 and 2022-02-04 02:32:46; pypath version: 0.14.1 (from git; 1e1c46c )
| Modules collected: | 150 |
|---|---|
| Modules failed to import: | 0 |
| Functions collected: | 468 |
| Functions run without error: | 325 |
| Functions returned empty value: | 9 |
| Functions skipped due to lack of arguments: | 118 |
| Functions run with error: | 25 |
| Function | Started | Finished | Elapsed (s) | Result type | Result repr | Result size | Error | Change since last time | Last succeeded | |
|---|---|---|---|---|---|---|---|---|---|---|
| ¶ | pypath.inputs.abs.abs_interactions | 2022-02-04 00:13:06 | 2022-02-04 00:13:07 | 0.42 | list | [['SRF', 'extracted04'], ['SRF', 'extracted04'], ['SRF', 'extracted04'], ['TEF1', 'extracted04'], ['SP1', 'extracted04'], ['TBP', 'extracted04'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['TEF1', 'X67686'], ['SP1', 'X67686'], ['TBP', 'X67686'], ['SRF', 'extracted05'], ['SRF', 'extrac...(truncated) | 650 | {} | 2022-02-04 00:13:06 | |
| ¶ | pypath.inputs.acsn.acsn_interactions | 2022-02-04 00:13:07 | 2022-02-04 00:13:07 | 0.63 | list | [AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CA', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454;15509806;16288288;17646672;18644865;20673124'), AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CB', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454...(truncated) | 37,725 | {} | 2022-02-04 00:13:07 | |
| ¶ | pypath.inputs.acsn.acsn_interactions_sif | 2022-02-04 00:13:07 | 2022-02-04 00:13:08 | 0.37 | list | [['ACHE', 'UNKNOWN_CATALYSIS', 'Cytochrome'], ['ACHE', 'UNKNOWN_CATALYSIS', 'APAF1'], ['E2F1', 'null', 'MIR17-3P'], ['E2F1', 'null', 'p14ARF'], ['E2F1', 'null', 'BAF250'], ['E2F1', 'null', 'HDAC1'], ['E2F1', 'null', 'HP1gamma'], ['E2F1', 'null', 'RB1'], ['E2F1', 'null', 'SUV39H1'], ['E2F1', 'null', ...(truncated) | 9,570 | {} | 2022-02-04 00:13:07 | |
| ¶ | pypath.inputs.adhesome.adhesome_annotations | 2022-02-04 00:13:08 | 2022-02-04 00:15:04 | 116.44 | dict | {'P12814': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'P23528': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q9BR76': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q14247': {AdhesomeAnnotation(mainclass='Actin regulation', intri...(truncated) | 239 | {} | 2022-02-04 00:13:08 | |
| ¶ | pypath.inputs.adhesome.adhesome_interactions | 2022-02-04 00:15:04 | 2022-02-04 00:15:04 | 0.29 | list | [AdhesomeInteraction(source='LPXN', target='GIT1', effect='0', type='Binding', pmid='12674328'), AdhesomeInteraction(source='GIT1', target='ARF1', effect='_', type='Inhibition', pmid='10896954'), AdhesomeInteraction(source='ARPC2', target='CTTN', effect='0', type='Binding', pmid='11018051'), Adhesom...(truncated) | 6,542 | {} | 2022-02-04 00:15:04 | |
| ¶ | pypath.inputs.almen2009.almen2009_annotations | 2022-02-04 00:15:04 | 2022-02-04 00:15:06 | 1.93 | dict | {'P04839': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transmembrane=5, sosui_transmembrane=5, tmhmm_transmembrane=4)}, 'Q9Y5S8': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transmembrane=5, sosui_transmembra...(truncated) | 4,827 | {} | 2022-02-04 00:15:04 | |
| ¶ | pypath.inputs.baccin2019.baccin2019_annotations | 2022-02-04 00:15:06 | 2022-02-04 00:17:04 | 117.57 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 195, in baccin2019_annotations
ia_all = baccin2019_interactions(ncbi_tax_id = ncbi_tax_id)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 136, in baccin2019_interactions
ligand_components = raw_to_uniprots(rec[1])
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 83, in raw_to_uniprots
itertools.product(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 84, in <genexpr>
*(id_translate(comp) for comp in components)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 65, in id_translate
itertools.chain(*(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 66, in <genexpr>
homology_mod.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 504, in load
self.load_ensembl(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 733, in load_ensembl
ensembl_data = biomart.biomart_homology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:14:40 | |||
| ¶ | pypath.inputs.baccin2019.baccin2019_interactions | 2022-02-04 00:17:04 | 2022-02-04 00:17:11 | 6.88 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 136, in baccin2019_interactions
ligand_components = raw_to_uniprots(rec[1])
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 83, in raw_to_uniprots
itertools.product(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 84, in <genexpr>
*(id_translate(comp) for comp in components)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 65, in id_translate
itertools.chain(*(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/baccin2019.py", line 66, in <genexpr>
homology_mod.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 504, in load
self.load_ensembl(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 733, in load_ensembl
ensembl_data = biomart.biomart_homology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:21:40 | |||
| ¶ | pypath.inputs.biogps.biogps_datasets | 2022-02-04 00:17:11 | 2022-02-04 00:17:11 | 0.00 | list | [BiogpsDataset(organism='human', label='human_gene_atlas_ave', url='http://plugins.biogps.org/download/gnf1h-gcrma.zip'), BiogpsDataset(organism='human', label='human_gene_atlas', url='http://plugins.biogps.org/download/gnf1h-gcrma-unaveraged.zip'), BiogpsDataset(organism='human', label='human_nci60...(truncated) | 9 | {} | 2022-02-04 00:17:11 | |
| ¶ | pypath.inputs.biogps.biogps_download |
Not calling `pypath.inputs.biogps.biogps_download`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biogps.biogps_download_all | 2022-02-04 00:17:11 | 2022-02-04 00:17:45 | 34.54 | dict | {'human_gene_atlas_ave': probe B_lymphoblasts ... retina small_intestine 0 1007_s_at 137.00 ... 880.675 168.15 1 1053_at 81.75 ... 9.900 8.50 2 117_at 12.55 ...(truncated) | 9 | {} | 2022-02-04 00:17:11 | |
| ¶ | pypath.inputs.biogrid.biogrid_interactions | 2022-02-04 00:17:46 | 2022-02-04 00:17:55 | 9.29 | list | [BiogridInteraction(partner_a='APOB', partner_b='MTTP', pmid='9915855'), BiogridInteraction(partner_a='CAPN3', partner_b='TTN', pmid='9642272'), BiogridInteraction(partner_a='CDKN3', partner_b='CDK2', pmid='12745075'), BiogridInteraction(partner_a='PPARGC1B', partner_b='ESR1', pmid='11854298'), Biog...(truncated) | 6,582 | {} | 2022-02-04 00:17:46 | |
| ¶ | pypath.inputs.biomart.biomart_homology | 2022-02-04 00:17:55 | 2022-02-04 00:17:56 | 0.17 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:22:29 | |||
| ¶ | pypath.inputs.biomart.biomart_microarray |
Not calling `pypath.inputs.biomart.biomart_microarray`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biomart.biomart_microarray_types | 2022-02-04 00:17:56 | 2022-02-04 00:17:56 | 0.31 | list | [{'description': None, 'vendor': 'PHALANX', 'type': 'OLIGO', 'format': 'EXPRESSION', 'array': 'OneArray', 'label': 'PHALANX OneArray'}, {'format': 'EXPRESSION', 'array': 'CODELINK', 'type': 'OLIGO', 'description': None, 'vendor': 'CODELINK', 'label': 'CODELINK CODELINK'}, {'array': 'HumanWG_6_V2', '...(truncated) | 38 | {} | 2022-02-04 00:17:56 | |
| ¶ | pypath.inputs.biomart.biomart_query |
Not calling `pypath.inputs.biomart.biomart_query`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ca1.ca1_interactions | 2022-02-04 00:17:56 | 2022-02-04 00:17:59 | 3.23 | list | [Ca1Interaction(source_label='GLYCINE', source_uniprot='NA', source_uniprot_mouse='NA', source_function='Ligand', source_location='Extracellular', target_label='NMDAR', target_uniprot='Q12879', target_uniprot_mouse='P35436', target_function='Receptor', target_location='Membrane', effect='+', interac...(truncated) | 1,788 | {} | 2022-02-04 00:17:56 | |
| ¶ | pypath.inputs.cancercellmap.ccmap_interactions | 2022-02-04 00:17:59 | 2022-02-04 00:18:00 | 0.95 | list | [CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q96S28', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q86YA7', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q4T...(truncated) | 47,644 | {} | 2022-02-04 00:17:59 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_annotations | 2022-02-04 00:18:00 | 2022-02-04 00:18:11 | 10.94 | defaultdict | defaultdict(<class 'set'>, {'46220502': {CancerDrugsAnnotation(label='Abemaciclib', indications='Advanced Breast Cancer; Metastatic Breast Cancer', last_updated='01/02/2022')}, '132971': {CancerDrugsAnnotation(label='Abiraterone', indications='Metastatic Castration Resistant Prostate Cancer', last_u...(truncated) | 199 | {} | 2022-02-04 00:18:00 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_download | 2022-02-04 00:18:11 | 2022-02-04 00:18:11 | 0.00 | list | [{'Product': 'Abemaciclib', 'EMA': 'Y', 'FDA': 'Y', 'EN': 'N', 'Other': '', 'WHO': 'N', 'Year': '2017', 'Generic': 'N', 'DrugBank ID': '<a href="https://go.drugbank.com/drugs/DB12001">DB12001</a>', 'ATC': 'L01EF03', 'ChEMBL': '<a href="https://www.ebi.ac.uk/chembl/compound_report_card/CHEMBL3301610"...(truncated) | 284 | {} | 2022-02-04 00:18:11 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_interactions | 2022-02-04 00:18:11 | 2022-02-04 00:18:11 | 0.34 | list | [CancerDrugsInteraction(source={'46220502'}, target={'Q00534'}), CancerDrugsInteraction(source={'46220502'}, target={'P11802'}), CancerDrugsInteraction(source={'46220502'}, target={'P24385'}), CancerDrugsInteraction(source={'46220502'}, target={'P30281'}), CancerDrugsInteraction(source={'46220502'},...(truncated) | 2,864 | {} | 2022-02-04 00:18:11 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_annotations | 2022-02-04 00:18:11 | 2022-02-04 00:18:11 | 0.12 | dict | {'46220502': {CancerdrugsdbAnnotation(drug_label='Abemaciclib', ema_approved=True, fda_approved=True, european_national_approved=False, who_approved=False, generic=False, approval_year=2017, indications=('Advanced Breast Cancer', 'Metastatic Breast Cancer'))}, '132971': {CancerdrugsdbAnnotation(drug...(truncated) | 188 | {} | 2022-02-04 00:18:11 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_download | 2022-02-04 00:18:11 | 2022-02-04 00:18:11 | 0.00 | list | [{'Product': 'Abemaciclib', 'EMA': 'Y', 'FDA': 'Y', 'EN': 'N', 'Other': '', 'WHO': 'N', 'Year': '2017', 'Generic': 'N', 'DrugBank ID': '<a href="https://go.drugbank.com/drugs/DB12001">DB12001</a>', 'ATC': 'L01EF03', 'ChEMBL': '<a href="https://www.ebi.ac.uk/chembl/compound_report_card/CHEMBL3301610"...(truncated) | 284 | {} | 2022-02-04 00:18:11 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_interactions | 2022-02-04 00:18:11 | 2022-02-04 00:18:12 | 0.11 | list | [CancerdrugsdbInteraction(drug_pubchem='46220502', drug_chembl='CHEMBL3301610', drug_drugbank='DB12001', drug_label='Abemaciclib', target_uniprot='P01111', ema_approved=True, fda_approved=True, european_national_approved=False, who_approved=False, generic=False, approval_year=2017, indications=('Adv...(truncated) | 2,378 | {} | 2022-02-04 00:18:11 | |
| ¶ | pypath.inputs.cancersea.cancersea_annotations | 2022-02-04 00:18:12 | 2022-02-04 00:18:13 | 1.60 | dict | {'P37023': {CancerseaAnnotation(state='Angiogenesis')}, 'P78504': {CancerseaAnnotation(state='Angiogenesis'), CancerseaAnnotation(state='Metastasis'), CancerseaAnnotation(state='Inflammation')}, 'Q15389': {CancerseaAnnotation(state='Angiogenesis')}, 'O15123': {CancerseaAnnotation(state='Angiogenesis...(truncated) | 1,246 | {} | 2022-02-04 00:18:12 | |
| ¶ | pypath.inputs.cell.cell_supplementary |
Not calling `pypath.inputs.cell.cell_supplementary`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellcall.cellcall_annotations | 2022-02-04 00:18:13 | 2022-02-04 00:18:15 | 1.61 | dict | {'P50591': {CellcallAnnotation(role='ligand')}, 'O14763': {CellcallAnnotation(role='receptor')}, 'P01138': {CellcallAnnotation(role='ligand')}, 'P08138': {CellcallAnnotation(role='receptor')}, 'P14210': {CellcallAnnotation(role='ligand')}, 'P22455': {CellcallAnnotation(role='receptor')}, 'O15444': {...(truncated) | 460 | {} | 2022-02-04 00:18:13 | |
| ¶ | pypath.inputs.cellcall.cellcall_download | 2022-02-04 00:18:15 | 2022-02-04 00:18:15 | 0.05 | list | [{'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '2626', 'Pathway': 'hsa04530_3,hsa04530_5', 'pathway_ID': 'hsa04530', 'Ligand_Symbol': 'OCLN', 'Receptor_Symbol': 'OCLN', 'TF_Symbol': 'GATA4'}, {'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '8531', 'Pathway': 'hsa045...(truncated) | 19,144 | {} | 2022-02-04 00:18:15 | |
| ¶ | pypath.inputs.cellcall.cellcall_download_all | 2022-02-04 00:18:15 | 2022-02-04 00:18:16 | 0.84 | list | [{'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '16150', 'Pathway': 'hsa04062_5', 'pathway_ID': 'hsa04062', 'Ligand_Symbol': 'Cxcl13', 'Receptor_Symbol': 'Xcr1', 'TF_Symbol': 'Ikbkb', 'extended': True, 'organism': 10090}, {'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '18033', 'Pat...(truncated) | 38,645 | {} | 2022-02-04 00:18:15 | |
| ¶ | pypath.inputs.cellcall.cellcall_interactions | 2022-02-04 00:18:16 | 2022-02-04 00:18:17 | 1.30 | list | [CellcallInteraction(ligand_uniprot='P50591', receptor_uniprot='O14763', core=True), CellcallInteraction(ligand_uniprot='P01138', receptor_uniprot='P08138', core=True), CellcallInteraction(ligand_uniprot='P14210', receptor_uniprot='P22455', core=True), CellcallInteraction(ligand_uniprot='O15444', re...(truncated) | 797 | {} | 2022-02-04 00:18:16 | |
| ¶ | pypath.inputs.cellcellinteractions.cellcellinteractions_annotations | 2022-02-04 00:18:17 | 2022-02-04 00:18:18 | 0.77 | dict | {'Q8IVN8': {CellcellinteractionsAnnotation(mainclass='ECM'), CellcellinteractionsAnnotation(mainclass='Receptor'), CellcellinteractionsAnnotation(mainclass='Ligand')}, 'O95967': {CellcellinteractionsAnnotation(mainclass='ECM'), CellcellinteractionsAnnotation(mainclass='Receptor'), Cellcellinteractio...(truncated) | 3,427 | {} | 2022-02-04 00:18:17 | |
| ¶ | pypath.inputs.cellchatdb._cellchatdb_organism | 2022-02-04 00:18:18 | 2022-02-04 00:18:18 | 0.00 | int | 9606 | None | {} | 2022-02-04 00:18:18 | |
| ¶ | pypath.inputs.cellchatdb._cellchatdb_process_cofactors |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_cofactors`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellchatdb._cellchatdb_process_complexes |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_complexes`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellchatdb.cellchatdb_annotations | 2022-02-04 00:18:18 | 2022-02-04 00:18:27 | 8.98 | dict | {'P01137': {CellChatDBAnnotation(role='ligand', pathway='TGFb', category='Secreted Signaling')}, Complex TGFbR1_R2: COMPLEX:P36897_P37173: {CellChatDBAnnotation(role='receptor', pathway='TGFb', category='Secreted Signaling')}, 'P19883': {CellChatDBAnnotation(role='agonist', pathway='TGFb', category=...(truncated) | 1,067 | {} | 2022-02-04 00:18:18 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_cofactors | 2022-02-04 00:18:27 | 2022-02-04 00:18:32 | 5.06 | dict | {'ACTIVIN antagonist': {'P19883'}, 'ACTIVIN inhibition receptor': {'Q13145'}, 'ANGPT inhibition receptor 1': {'P35590'}, 'ANGPT inhibition receptor 2': {'P23467'}, 'BMP antagonist': {'P41271', 'Q9H772', 'Q9H2X0', 'P12645', 'O60565', 'Q13253', 'O00292', 'O75610'}, 'BMP inhibition receptor': {'Q13145'...(truncated) | 31 | {} | 2022-02-04 00:18:27 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_complexes | 2022-02-04 00:18:32 | 2022-02-04 00:18:37 | 5.04 | dict | {'COMPLEX:P08476_P09529': Complex Activin AB: COMPLEX:P08476_P09529, 'COMPLEX:P05111_P08476': Complex Inhibin A: COMPLEX:P05111_P08476, 'COMPLEX:P05111_P09529': Complex Inhibin B: COMPLEX:P05111_P09529, 'COMPLEX:P29459_P29460': Complex IL12AB: COMPLEX:P29459_P29460, 'COMPLEX:P29460_Q9NPF7': Complex ...(truncated) | 153 | {} | 2022-02-04 00:18:32 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_download | 2022-02-04 00:18:37 | 2022-02-04 00:18:43 | 5.67 | dict | {'interaction': interaction_name ... rownames 0 TGFB1_TGFBR1_TGFBR2 ... TGFB1_TGFBR1_TGFBR2 1 TGFB2_TGFBR1_TGFBR2 ... TGFB2_TGFBR1_TGFBR2 2 TGFB3_TGFBR1_TGFBR2 ... TGFB3_TGFBR1_TGFBR2 3 TGFB1_ACVR1B_TGFBR2 ... TGFB1_ACVR1B_TGFBR2 4 TGFB1_ACVR1C_TGFBR...(truncated) | 4 | {} | 2022-02-04 00:18:37 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_interactions | 2022-02-04 00:18:43 | 2022-02-04 00:18:48 | 5.26 | list | [CellChatDBInteraction(id_a='P01137', id_b=Complex TGFbR1_R2: COMPLEX:P36897_P37173, role_a='ligand', role_b='receptor', effect='unknown', pathway='TGFb', refs=[], category='Secreted Signaling'), CellChatDBInteraction(id_a='P19883', id_b='P01137', role_a='agonist', role_b='ligand', effect='stimulati...(truncated) | 11,113 | {} | 2022-02-04 00:18:43 | |
| ¶ | pypath.inputs.cellinker._cellinker_interactions_raw | 2022-02-04 00:18:48 | 2022-02-04 00:18:49 | 0.33 | list | [{'Ligand_id': '1000', 'Ligand_symbol': 'CDH2', 'Ligand_location': 'Membrane', 'Receptor_id': '1000', 'Receptor_symbol': 'CDH2', 'Receptor.location': 'Membrane', 'Type': 'Cell adhesion', 'KEGG.pathway': 'hsa04514:Cell adhesion molecules (CAMs)', 'Pmubmed.ID': '32196115', 'Other.DB': '', 'LRID': 'LR0...(truncated) | 3,744 | {} | 2022-02-04 00:18:48 | |
| ¶ | pypath.inputs.cellinker._cellinker_uniprots |
Not calling `pypath.inputs.cellinker._cellinker_uniprots`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellinker.cellinker_annotations | 2022-02-04 00:18:49 | 2022-02-04 00:18:49 | 0.63 | dict | {'P01275': {CellinkerAnnotation(role='ligand', location='Secreted', type='Secreted protein to receptor interaction')}, 'P27487': {CellinkerAnnotation(role='receptor', location='Membrane', type='Cytokine-cytokine receptor interaction'), CellinkerAnnotation(role='receptor', location='Membrane', type='...(truncated) | 1,921 | {} | 2022-02-04 00:18:49 | |
| ¶ | pypath.inputs.cellinker.cellinker_complex_annotations | 2022-02-04 00:18:49 | 2022-02-04 00:18:50 | 0.53 | dict | {Complex: COMPLEX:P26951_P32927: {CellinkerAnnotation(role='receptor', location='Membrane', type='Cytokine-cytokine receptor interaction')}, Complex: COMPLEX:O60353_O75581: {CellinkerAnnotation(role='receptor', location='Membrane', type='Secreted protein to receptor interaction')}, Complex: COMPLEX:...(truncated) | 134 | {} | 2022-02-04 00:18:49 | |
| ¶ | pypath.inputs.cellinker.cellinker_complexes | 2022-02-04 00:18:50 | 2022-02-04 00:18:50 | 0.02 | dict | {'COMPLEX:O75462_Q9UBD9': Complex: COMPLEX:O75462_Q9UBD9, 'COMPLEX:P14770_P40197': Complex: COMPLEX:P14770_P40197, 'COMPLEX:P01857_P0CG04': Complex: COMPLEX:P01857_P0CG04, 'COMPLEX:P29460_Q9NPF7': Complex: COMPLEX:P29460_Q9NPF7, 'COMPLEX:P29459_Q8NEV9': Complex: COMPLEX:P29459_Q8NEV9, 'COMPLEX:Q0477...(truncated) | 143 | {} | 2022-02-04 00:18:50 | |
| ¶ | pypath.inputs.cellinker.cellinker_complexes_raw | 2022-02-04 00:18:50 | 2022-02-04 00:18:50 | 0.01 | list | [CellinkerComplex(role='ligand', cellinker_id='CH0131', components=(CellinkerComplexComponent(genesymbol='CRLF1', entrez='9244'), CellinkerComplexComponent(genesymbol='CLCF1', entrez='23529')), location='Secreted'), CellinkerComplex(role='ligand', cellinker_id='CH0132', components=(CellinkerComplexC...(truncated) | 145 | {} | 2022-02-04 00:18:50 | |
| ¶ | pypath.inputs.cellinker.cellinker_lr_interactions | 2022-02-04 00:18:50 | 2022-02-04 00:18:50 | 0.52 | set | {CellinkerInteraction(ligand='P01275', receptor='P27487', ligand_location='Secreted', receptor_location='Membrane', resources=None, pmids='21314817;15655705', type='Secreted protein to receptor interaction'), CellinkerInteraction(ligand='P57739', receptor='P57739', ligand_location='Membrane', recept...(truncated) | 3,812 | {} | 2022-02-04 00:18:50 | |
| ¶ | pypath.inputs.cellinker.cellinker_lr_interactions_raw | 2022-02-04 00:18:50 | 2022-02-04 00:18:50 | 0.01 | list | [{'Ligand_id': '1000', 'Ligand_symbol': 'CDH2', 'Ligand_location': 'Membrane', 'Receptor_id': '1000', 'Receptor_symbol': 'CDH2', 'Receptor.location': 'Membrane', 'Type': 'Cell adhesion', 'KEGG.pathway': 'hsa04514:Cell adhesion molecules (CAMs)', 'Pmubmed.ID': '32196115', 'Other.DB': '', 'LRID': 'LR0...(truncated) | 3,744 | {} | 2022-02-04 00:18:50 | |
| ¶ | pypath.inputs.cellinker.cellinker_protein_annotations | 2022-02-04 00:18:50 | 2022-02-04 00:18:51 | 0.54 | dict | {'P01275': {CellinkerAnnotation(role='ligand', location='Secreted', type='Secreted protein to receptor interaction')}, 'P27487': {CellinkerAnnotation(role='receptor', location='Membrane', type='Cytokine-cytokine receptor interaction'), CellinkerAnnotation(role='receptor', location='Membrane', type='...(truncated) | 1,787 | {} | 2022-02-04 00:18:50 | |
| ¶ | pypath.inputs.cellinker.cellinker_smol_interactions | 2022-02-04 00:18:51 | 2022-02-04 00:18:51 | 0.21 | set | {CellinkerInteraction(ligand='123953', receptor='O94759', ligand_location=None, receptor_location='Membrane', resources='Guide2Pharma', pmids='16585058', type='sMOL-receptor interaction'), CellinkerInteraction(ligand='105074', receptor='Q7Z4N2', ligand_location=None, receptor_location='Membrane', re...(truncated) | 315 | {} | 2022-02-04 00:18:51 | |
| ¶ | pypath.inputs.cellinker.cellinker_smol_interactions_raw | 2022-02-04 00:18:51 | 2022-02-04 00:18:51 | 0.00 | list | [{'ligand_pubchem_sid': '135651413', 'ligand_pubchem_cid': '5202', 'ligand name': '5-hydroxytryptamine', 'ligand_type': 'Metabolite', 'Receptor_id': '3350', 'Receptor_symbol': 'HTR1A', 'Receptor_uniprot': 'P08908', 'Receptor_location': 'Membrane', 'Type': 'sMOL-receptor interaction', 'target_species...(truncated) | 341 | {} | 2022-02-04 00:18:51 | |
| ¶ | pypath.inputs.cellinker.components_to_complex |
Not calling `pypath.inputs.cellinker.components_to_complex`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_annotations |
Not calling `pypath.inputs.cellphonedb._cellphonedb_annotations`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_get_entity |
Not calling `pypath.inputs.cellphonedb._cellphonedb_get_entity`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_hla |
Not calling `pypath.inputs.cellphonedb._cellphonedb_hla`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb.cellphonedb_complex_annotations | 2022-02-04 00:18:51 | 2022-02-04 00:18:51 | 0.23 | dict | {Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('receptor',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('...(truncated) | 112 | {} | 2022-02-04 00:18:51 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_complexes | 2022-02-04 00:18:51 | 2022-02-04 00:18:51 | 0.02 | dict | {'COMPLEX:P37023_Q13873': Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873, 'COMPLEX:Q04771_Q13873': Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873, 'COMPLEX:P27037_Q04771': Complex ACVR_1A2A receptor: COMPLEX:P27037_Q04771, 'COMPLEX:Q04771_Q13705': Complex ACVR_1A2B receptor: COMPLEX:Q04771_Q13705, 'COMPLEX:...(truncated) | 112 | {} | 2022-02-04 00:18:51 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_interactions | 2022-02-04 00:18:51 | 2022-02-04 00:18:52 | 0.52 | list | [CellphonedbInteraction(id_a=Complex IL12: COMPLEX:P29459_P29460, id_b=Complex IL12 receptor: COMPLEX:P42701_Q99665, sources='CellPhoneDB', references='', interaction_type='ligand-receptor', type_a='ligand', type_b='receptor'), CellphonedbInteraction(id_a=Complex Activin ligand ab: COMPLEX:P08476_P0...(truncated) | 1,396 | {} | 2022-02-04 00:18:51 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_ligands_receptors | 2022-02-04 00:18:52 | 2022-02-04 00:18:52 | 0.05 | tuple | ({'P26927', 'P48023', 'Q8WXF3', 'P78423', 'Q8IZJ0', 'Q9NZH7', 'P01583', 'P10912', 'P52803', 'Q13007', 'Q03167', 'O43927', 'P27487', 'Q9UBD3', 'P35916', 'P04004', 'P12272', 'P19438', 'P0DJI8', 'Q15726', 'P01282', 'P05997', 'P07602', 'Q14055', 'Q9NRM6', 'Q9UBH0', 'P31997', 'P30990', 'Q96LC7', 'O95813'...(truncated) | 2 | {} | 2022-02-04 00:18:52 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_protein_annotations | 2022-02-04 00:18:52 | 2022-02-04 00:18:52 | 0.04 | dict | {'A4D1S0': CellPhoneDBAnnotation(receptor=True, receptor_class=('klr',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), 'A6NMZ7': CellPhoneDBAnnotation(receptor=False, receptor_class=(), peripheral=False, secreted=True, secreted_class=('secreted',), transme...(truncated) | 978 | {} | 2022-02-04 00:18:52 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_annotations | 2022-02-04 00:18:52 | 2022-02-04 00:19:05 | 12.50 | dict | {'Q13275': {CellTalkDBAnnotation(role='ligand', pmid='26156437'), CellTalkDBAnnotation(role='ligand', pmid='9883722'), CellTalkDBAnnotation(role='ligand', pmid='15721238')}, 'P51805': {CellTalkDBAnnotation(role='receptor', pmid='32196115'), CellTalkDBAnnotation(role='receptor', pmid='15721238')}, 'Q...(truncated) | 1,598 | {} | 2022-02-04 00:18:52 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_download | 2022-02-04 00:19:05 | 2022-02-04 00:19:05 | 0.00 | list | [CellTalkDbRecord(lr_pair='SEMA3F_PLXNA3', ligand_gene_symbol='SEMA3F', receptor_gene_symbol='PLXNA3', ligand_gene_id='6405', receptor_gene_id='55558', ligand_ensembl_protein_id='ENSP00000002829', receptor_ensembl_protein_id='ENSP00000358696', ligand_ensembl_gene_id='ENSG00000001617', receptor_ensem...(truncated) | 3,398 | {} | 2022-02-04 00:19:05 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_interactions | 2022-02-04 00:19:05 | 2022-02-04 00:19:05 | 0.01 | list | [CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA3', reference='15721238'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA1', reference='26156437'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='NRP1', reference='9883...(truncated) | 3,398 | {} | 2022-02-04 00:19:05 | |
| ¶ | pypath.inputs.celltypist.celltypist_annotations | 2022-02-04 00:19:05 | 2022-02-04 00:19:05 | 0.30 | dict | {'P11836': {CelltypistAnnotation(cell_type='B cells', cell_subtype='Memory B cells', cell_ontology='CL:0000787', marker_type='curated_marker', tissues=('Blood', 'Bone marrow', 'Colon', 'Kidney', 'Mesenteric lymph node', 'Oesophagus', 'Omentum adipose tissue', 'Spleen', 'Thymus'), datasets=('HCA Immu...(truncated) | 474 | {} | 2022-02-04 00:19:05 | |
| ¶ | pypath.inputs.compleat.compleat_complexes | 2022-02-04 00:19:05 | 2022-02-04 00:19:09 | 3.78 | dict | {'COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0': Complex: COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0, 'COMPLEX:O43681_O75396_P0CG48_P11441_Q7L5D6_Q8NEP3_Q96DZ5_Q9...(truncated) | 9,693 | {} | 2022-02-04 00:19:05 | |
| ¶ | pypath.inputs.compleat.compleat_raw | 2022-02-04 00:19:09 | 2022-02-04 00:19:09 | 0.06 | list | [{'compleat_id': 'HC4831', 'member_count': '15', 'predicted': 'Predicted', 'functions': 'protein transport', 'functions2': 'protein transport;cellular membrane fusion;Golgi vesicle transport;vesicle-mediated transport;intracellular transport', 'nothing': '', 'sources': 'NetworkBlast', 'name': '', 'm...(truncated) | 9,704 | {} | 2022-02-04 00:19:09 | |
| ¶ | pypath.inputs.complexportal.complexportal_complexes | 2022-02-04 00:19:09 | 2022-02-04 00:19:53 | 44.19 | dict | {'COMPLEX:P84022_Q13485_Q15796': Complex SMAD2-SMAD3-SMAD4 complex: COMPLEX:P84022_Q13485_Q15796, 'COMPLEX:P16220_P18848': Complex bZIP transcription factor complex, ATF4-CREB1: COMPLEX:P16220_P18848, 'COMPLEX:P18846_P18848': Complex bZIP transcription factor complex, ATF1-ATF4: COMPLEX:P18846_P1884...(truncated) | 1,191 | {} | 2022-02-04 00:19:09 | |
| ¶ | pypath.inputs.comppi.comppi_interaction_locations | 2022-02-04 00:19:53 | 2022-02-04 00:20:48 | 55.00 | list | [ComppiInteraction(id_a='Q8TES7', id_b='O75478', loc_a=(ComppiLocation(location='cytosol', score=0.8), ComppiLocation(location='nucleus', score=0.7)), loc_b=(ComppiLocation(location='nucleus', score=0.8),)), ComppiInteraction(id_a='Q8TES7', id_b='O75478', loc_a=(ComppiLocation(location='cytosol', sc...(truncated) | 591,025 | {} | 2022-02-04 00:19:53 | |
| ¶ | pypath.inputs.comppi.comppi_locations | 2022-02-04 00:20:48 | 2022-02-04 00:21:46 | 57.70 | dict | {'Q8TES7': {ComppiLocation(location='cytosol', score=0.9099999999999999), ComppiLocation(location='cytosol', score=0.99997984), ComppiLocation(location='nucleus', score=0.7), ComppiLocation(location='nucleus', score=0.9099999999999999), ComppiLocation(location='cytosol', score=0.8), ComppiLocation(l...(truncated) | 18,233 | {} | 2022-02-04 00:20:48 | |
| ¶ | pypath.inputs.connectomedb.connectomedb_annotations | 2022-02-04 00:21:46 | 2022-02-04 00:21:46 | 0.46 | dict | {'P01023': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'Q07954': {ConnectomedbAnnotation(role='receptor', location='plasma membrane')}, 'Q16613': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'P48039': {ConnectomedbAnnotation(role='receptor', location='plasma membra...(truncated) | 1,428 | {} | 2022-02-04 00:21:46 | |
| ¶ | pypath.inputs.connectomedb.connectomedb_interactions | 2022-02-04 00:21:46 | 2022-02-04 00:21:46 | 0.02 | list | [ConnectomedbInteraction(ligand='A2M', ligand_location=['secreted'], receptor='LRP1', references=['1702392', '10652313', '12194978']), ConnectomedbInteraction(ligand='AANAT', ligand_location=['secreted'], receptor='MTNR1A', references=['12943195']), ConnectomedbInteraction(ligand='AANAT', ligand_loc...(truncated) | 2,293 | {} | 2022-02-04 00:21:46 | |
| ¶ | pypath.inputs.corum.corum_complexes | 2022-02-04 00:21:46 | 2022-02-04 00:21:47 | 1.26 | dict | {'COMPLEX:P41182_P56524': Complex BCL6-HDAC4 complex: COMPLEX:P41182_P56524, 'COMPLEX:P41182_Q9UQL6': Complex BCL6-HDAC5 complex: COMPLEX:P41182_Q9UQL6, 'COMPLEX:P41182_Q8WUI4': Complex BCL6-HDAC7 complex: COMPLEX:P41182_Q8WUI4, 'COMPLEX:Q09472_Q92793_Q92831_Q9Y6Q9': Complex Multisubunit ACTR coacti...(truncated) | 2,734 | {} | 2022-02-04 00:21:46 | |
| ¶ | pypath.inputs.cosmic.cancer_gene_census_annotations | 2022-02-04 00:21:47 | 2022-02-04 00:21:50 | 2.09 | dict | {'Q9NQ94': {CancerGeneCensusAnnotation(tier=2, hallmark=False, somatic=True, germline=False, tumour_types_somatic=('melanoma',), tumour_types_germline=(), cancer_syndrome=(), tissue_type=('E',), genetics=None, role=('oncogene',), mutation_type=('Mis',))}, 'Q8IZP0': {CancerGeneCensusAnnotation(tier=1...(truncated) | 725 | {} | 2022-02-04 00:21:47 | |
| ¶ | pypath.inputs.cpad.cpad_annotations | 2022-02-04 00:21:50 | 2022-02-04 00:21:56 | 6.35 | dict | {'Q16181': {CpadAnnotation(regulator_type='protein', effect_on_pathway='Upregulation', pathway='Actin cytoskeleton pathway', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='inhibit glioma cell migration', cancer='Glioma', pathway_category='Regulation of actin cytoskeleton')}, 'MIMAT0000431'...(truncated) | 1,036 | {'size': -1} | 2022-02-04 00:21:50 | |
| ¶ | pypath.inputs.cpad.cpad_pathway_cancer | 2022-02-04 00:21:56 | 2022-02-04 00:21:56 | 0.06 | tuple | ({'Glioma': {CpadPathwayCancer(pathway='Wnt/beta-catenin signaling pathway', cancer='Glioma', pathway_category='Wnt signaling pathway', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='suppress glioma cell proliferation, migration, and invasion'), CpadPathwayCancer(pathway='IL-6/Jak/STAT3 si...(truncated) | 2 | {} | 2022-02-04 00:21:56 | |
| ¶ | pypath.inputs.cpad.get_cpad | 2022-02-04 00:21:56 | 2022-02-04 00:21:56 | 0.05 | list | [{'Regulator': 'NULL', 'Regulator_Type': 'NULL', 'Pathway': '5-LO/LTA4 hydrolase pathway', 'Pathway_Category': 'Others', 'KEGG_ID': 'NULL', 'Regulation_Type': 'Inhibiting', 'Cancer': 'Glioma', 'ID': 'H00042', 'Outcome_Description': 'partial suppression of tumor growth', 'Description': 'We confirmed ...(truncated) | 4,709 | {} | 2022-02-04 00:21:56 | |
| ¶ | pypath.inputs.cpdb.cpdb_interactions | 2022-02-04 00:21:56 | 2022-02-04 00:22:00 | 3.74 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 531,371 | {} | 2022-02-04 00:21:56 | |
| ¶ | pypath.inputs.cpdb.cpdb_interactions_ltp | 2022-02-04 00:22:00 | 2022-02-04 00:22:03 | 2.44 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 482,222 | {} | 2022-02-04 00:22:00 | |
| ¶ | pypath.inputs.cspa.cspa_annotations | 2022-02-04 00:22:03 | 2022-02-04 00:22:04 | 1.18 | dict | {'P08473': {CspaAnnotation(high_confidence=True, n_cell_types=29, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q92854': {CspaAnnotation(high_confidence=True, n_cell_types=26, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q93033': {CspaAnnotation(high_confidence=True, n_cell_types=6, tm=1, gpi=0, uniprot_...(truncated) | 1,446 | {} | 2022-02-04 00:22:03 | |
| ¶ | pypath.inputs.cspa.cspa_cell_type_annotations | 2022-02-04 00:22:04 | 2022-02-04 00:22:07 | 3.25 | dict | {'A1A5B4': {CspaCellType(cell_type='CD4pCD25n_Tcells', value=18.59847), CspaCellType(cell_type='ZL55', value=18.74705), CspaCellType(cell_type='SUDHL6', value=16.57829), CspaCellType(cell_type='HBL1', value=17.03274), CspaCellType(cell_type='MedB1', value=17.42748), CspaCellType(cell_type='HDLM2', v...(truncated) | 1,407 | {} | 2022-02-04 00:22:04 | |
| ¶ | pypath.inputs.cspa.cspa_cell_types | 2022-02-04 00:22:07 | 2022-02-04 00:22:10 | 2.44 | dict | {'A431': {'A1A5B4': 16.56885, 'A1A5C7': None, 'A0A0B4J2A2': None, 'P0DN37': None, 'A2RU67': None, 'A2VDJ0': None, 'A6NGN9': None, 'A6NI73': None, 'A6NKL6': None, 'A6NMZ7': 16.08666, 'A7MBM2': 15.11804, 'A8MVW0': None, 'A8MVW5': None, 'A8MWY0': None, 'A8TX70': None, 'O00116': None, 'O00206': 15.9843,...(truncated) | 47 | {} | 2022-02-04 00:22:07 | |
| ¶ | pypath.inputs.dbptm.dbptm_enzyme_substrate | 2022-02-04 00:22:10 | 2022-02-04 00:22:13 | 2.73 | list | [{'substrate': 'P30443', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end': 116, 'instance': 'TLRGYYNQSEDGS', 'typ': 'n-linked glycosylation', 'source': 'Swiss-Prot', 'references': ['19159218']}, {'substrate': 'P01892', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end':...(truncated) | 223,135 | {} | 2022-02-04 00:22:10 | |
| ¶ | pypath.inputs.dbptm.dbptm_enzyme_substrate_old | 2022-02-04 00:22:13 | 2022-02-04 00:22:15 | 2.32 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/dbptm.py", line 101, in dbptm_enzyme_substrate_old
for k, data in iteritems(extra):
File "/usr/lib/python3/dist-packages/future/utils/__init__.py", line 311, in iteritems
func = obj.items
AttributeError: 'NoneType' object has no attribute 'items'
|
{} | 2022-01-07 23:35:25 | |||
| ¶ | pypath.inputs.dbptm.dbptm_interactions | 2022-02-04 00:22:15 | 2022-02-04 00:22:16 | 0.89 | list | [['PKA', 'P63104', '11956222;12865427;15883165;16376338'], ['PKB', 'P63104', '11956222;12865427;15883165;16376338'], ['MAPK8', 'P63104', '15071501;15696159'], ['CDK1', 'P11171', '2171679;15525677;18220336;18669648'], ['MAPK1', 'Q13541', '12747827;17081983;17287340;18187866;18669648'], ['CK2', 'P0506...(truncated) | 2,071 | {} | 2022-02-04 00:22:15 | |
| ¶ | pypath.inputs.deathdomain.deathdomain_interactions | 2022-02-04 00:22:16 | 2022-02-04 00:22:17 | 1.21 | list | [] | 0 | {} | 2022-02-04 00:22:16 | |
| ¶ | pypath.inputs.deathdomain.deathdomain_interactions_rescued | 2022-02-04 00:22:17 | 2022-02-04 00:22:18 | 0.17 | list | [['Apaf1', 'Caspase9', 'GST fusion protein pull-down;In vitro purification protein assembly(Size-exclusion chromatography);Yeast two-hybrid;Co-immunoprecipitation;Size-exclusion chromatography;Structure;Gel filtration;β-galactosidase staining;DAPI staining;Caspase cleaved assay', '9390557;9922454;11...(truncated) | 184 | {} | 2022-02-04 00:22:17 | |
| ¶ | pypath.inputs.depod.depod_enzyme_substrate | 2022-02-04 00:22:18 | 2022-02-04 00:22:18 | 0.13 | list | [{'instance': None, 'kinase': 'P08575', 'resaa': 'Y', 'resnum': 1054, 'references': ['11201744'], 'substrate': 'P29597', 'start': None, 'end': None, 'typ': 'dephosphorylation'}, {'instance': None, 'kinase': 'P08575', 'resaa': 'Y', 'resnum': 1055, 'references': ['11201744'], 'substrate': 'P29597', 's...(truncated) | 537 | {} | 2022-02-04 00:22:18 | |
| ¶ | pypath.inputs.depod.depod_interactions | 2022-02-04 00:22:18 | 2022-02-04 00:22:18 | 0.01 | list | [('P15309', 'P04626', '11067847|9705354', '2', 'dephosphorylation reaction'), ('Q9BZG2', 'Q15303', '15219672', '1', 'dephosphorylation reaction'), ('P05186', 'P0C0S8', '6167574', '1', 'dephosphorylation reaction'), ('P05186', 'Q92934', 'PMC3005908', '1', 'dephosphorylation reaction'), ('P49593', 'Q1...(truncated) | 832 | {} | 2022-02-04 00:22:18 | |
| ¶ | pypath.inputs.dgidb.dgidb_annotations | 2022-02-04 00:22:18 | 2022-02-04 00:22:21 | 2.87 | dict | {'Q9BXS1': {DgidbAnnotation(category='ENZYME')}, 'Q9BZH6': {DgidbAnnotation(category='TRANSCRIPTION FACTOR')}, 'Q96Q89': {DgidbAnnotation(category='ENZYME')}, 'Q99470': {DgidbAnnotation(category='DRUGGABLE GENOME')}, 'Q9H211': {DgidbAnnotation(category='KINASE')}, 'O95069': {DgidbAnnotation(category...(truncated) | 10,494 | {} | 2022-02-04 00:22:18 | |
| ¶ | pypath.inputs.dgidb.get_dgidb_old | 2022-02-04 00:22:21 | 2022-02-04 00:23:38 | 77.42 | set | {'Q9HCC0', 'Q86Y01', 'Q8IVL8', 'Q13555', 'P28222', 'Q8NGV5', 'P26358', 'P46095', 'Q7Z4K8', 'Q9UHP3', 'Q9H422', 'Q8N2Z9', 'Q8NGD1', 'O15111', 'P35228', 'Q6DN72', 'O14980', 'P14061', 'P54793', 'O14936', 'Q9UJM3', 'Q9NRR5', 'Q6DT37', 'Q86Y22', 'O60895', 'P78329', 'A4D2G3', 'Q96D53', 'Q8IZE3', 'Q86U17',...(truncated) | 5,899 | {} | 2022-02-04 00:22:21 | |
| ¶ | pypath.inputs.dip.dip_interactions | 2022-02-04 00:23:38 | 2022-02-04 00:23:38 | 0.30 | list | [['P01730', 'P01730', '9168119;9168119', 'direct interaction', 'x-ray crystallography;protein cross-linking with a bifunctional reagent', 'DIP-42E'], ['P29375', 'P06400', '8414517;22615382;22615382', 'physical interaction;physical association', 'biochemical;anti bait coimmunoprecipitation', 'DIP-214...(truncated) | 2,283 | {} | 2022-02-04 00:23:38 | |
| ¶ | pypath.inputs.dip.dip_login |
Not calling `pypath.inputs.dip.dip_login`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.disgenet.disgenet_annotations | 2022-02-04 00:23:38 | 2022-02-04 00:23:43 | 5.07 | dict | {'P04217': {DisGeNetAnnotation(disease='Hepatomegaly', type='phenotype', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',)), DisGeNetAnnotation(disease='Schizophrenia', type='disease', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',))}, 'P0102...(truncated) | 9,202 | {} | 2022-02-04 00:23:38 | |
| ¶ | pypath.inputs.domino.domino_ddi | 2022-02-04 00:23:44 | 2022-02-04 00:24:07 | 23.05 | list | [<pypath.internals.intera.DomainDomain object at 0x7f45e7ab5eb0>, <pypath.internals.intera.DomainDomain object at 0x7f45e7ab5520>, <pypath.internals.intera.DomainDomain object at 0x7f45e7ab58e0>, <pypath.internals.intera.DomainDomain object at 0x7f45e7ab5880>, <pypath.internals.intera.DomainDomain o...(truncated) | 1,294 | {} | 2022-02-04 00:23:44 | |
| ¶ | pypath.inputs.domino.domino_enzsub | 2022-02-04 00:24:07 | 2022-02-04 00:24:08 | 0.96 | dict | {'ddi': [<pypath.internals.intera.DomainDomain object at 0x7f45e442bdc0>, <pypath.internals.intera.DomainDomain object at 0x7f45e442b9a0>, <pypath.internals.intera.DomainDomain object at 0x7f45e442bd60>, <pypath.internals.intera.DomainDomain object at 0x7f45e4b70220>, <pypath.internals.intera.Domain...(truncated) | 2 | {} | 2022-02-04 00:24:07 | |
| ¶ | pypath.inputs.domino.domino_interactions | 2022-02-04 00:24:08 | 2022-02-04 00:24:08 | 0.40 | list | [DominoRecord(uniprot_A='A4GZ26', uniprot_B='Q8BKX1', isoform_A='1', isoform_B='1', exp_method='two hybrid', references='10.1016/j.brainres.2008.11.061', taxon_A='10090', taxon_B='10090', role_A='physical association', role_B='unspecified role', binding_site_range_A='1424-1434', binding_site_range_B...(truncated) | 6,687 | {} | 2022-02-04 00:24:08 | |
| ¶ | pypath.inputs.domino.get_domino | 2022-02-04 00:24:08 | 2022-02-04 00:24:08 | 0.37 | list | [DominoRecord(uniprot_A='O00459', uniprot_B='', isoform_A='1', isoform_B='', exp_method='', references='', taxon_A='9606', taxon_B='', role_A='mint', role_B='neutral component', binding_site_range_A='4-80', binding_site_range_B='', domains_A='', domains_B='', ptm_residue_A='', ptm_residue_B='', ptm_...(truncated) | 14,539 | {} | 2022-02-04 00:24:08 | |
| ¶ | pypath.inputs.dorothea._process_resources |
Not calling `pypath.inputs.dorothea._process_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.dorothea.dorothea_full_raw | 2022-02-04 00:24:09 | 2022-02-04 00:24:16 | 7.94 | DataFrame | tf target mor ... which_inferred which_tfbs pubmed_id 0 ADNP AASDH 0.0 ... gtex none - 1 ADNP AASDHPPT 0.0 ... gtex none - 2 ADNP ABCB10 0.0 ... gtex none - 3 ADN...(truncated) | 1,019,220 | {} | 2022-02-04 00:24:09 | |
| ¶ | pypath.inputs.dorothea.dorothea_interactions | 2022-02-04 00:24:17 | 2022-02-04 00:24:31 | 14.13 | list | [DorotheaInteraction(tf='ADNP', target='ABCC1', effect=0, level='D', curated=False, chipseq=True, predicted=False, coexp=False, curated_sources='', chipseq_sources='ReMap', predicted_sources='', coexp_sources='', all_sources='ReMap', pubmed='', kegg_pathways=''), DorotheaInteraction(tf='ADNP', targe...(truncated) | 309,009 | {} | 2022-02-04 00:24:17 | |
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-02-04 00:24:31 | 2022-02-04 00:24:31 | 0.30 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 784, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-02-04 00:24:31 | 2022-02-04 00:24:31 | 0.11 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 784, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.dorothea.dorothea_rda_raw | 2022-02-04 00:24:31 | 2022-02-04 00:24:33 | 1.87 | DataFrame | tf confidence target mor 0 ADNP D ATF7IP 1.0 1 ADNP D DYRK1A 1.0 2 ADNP D TLK1 1.0 3 ADNP D ZMYM4 1.0 4 ADNP D ABCC1 1.0 ... ... ... ... ... 454499 ZZZ3 D ZBTB20 1.0 4545...(truncated) | 454,504 | {} | 2022-02-04 00:24:31 | |
| ¶ | pypath.inputs.dorothea.get_dorothea_old | 2022-02-04 00:24:33 | 2022-02-04 00:24:33 | 0.38 | list | [['AHR', 'CYP1A1', '0', 'A', True, False, True, False, 'HTRIdb,trrust_signed', '', 'hocomoco_v11', '', 'HTRIdb,trrust_signed,hocomoco_v11'], ['AHR', 'CYP1A2', '0', 'A', True, False, False, False, 'HTRIdb,trrust_signed', '', '', '', 'HTRIdb,trrust_signed'], ['AHR', 'CYP1B1', '0', 'A', True, False, Tr...(truncated) | 14,260 | {} | 2022-02-04 00:24:33 | |
| ¶ | pypath.inputs.dorothea.dorothea_rda_raw | 2022-02-04 00:24:33 | 2022-02-04 00:24:35 | 1.23 | DataFrame | tf confidence target mor 0 ADNP D ATF7IP 1.0 1 ADNP D DYRK1A 1.0 2 ADNP D TLK1 1.0 3 ADNP D ZMYM4 1.0 4 ADNP D ABCC1 1.0 ... ... ... ... ... 454499 ZZZ3 D ZBTB20 1.0 4545...(truncated) | 454,504 | {} | 2022-02-04 00:24:33 | |
| ¶ | pypath.inputs.dorothea.dorothea_interactions | 2022-02-04 00:24:35 | 2022-02-04 00:24:49 | 13.99 | list | [DorotheaInteraction(tf='ADNP', target='ABCC1', effect=0, level='D', curated=False, chipseq=True, predicted=False, coexp=False, curated_sources='', chipseq_sources='ReMap', predicted_sources='', coexp_sources='', all_sources='ReMap', pubmed='', kegg_pathways=''), DorotheaInteraction(tf='ADNP', targe...(truncated) | 309,009 | {} | 2022-02-04 00:24:35 | |
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-02-04 00:24:49 | 2022-02-04 00:24:49 | 0.13 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 784, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.ebi.ebi_rest |
Not calling `pypath.inputs.ebi.ebi_rest`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.elm.elm_classes | 2022-02-04 00:24:49 | 2022-02-04 00:24:49 | 0.17 | dict | {'CLV_C14_Caspase3-7': ELMClass(accession='ELME000321', identifier='CLV_C14_Caspase3-7', functional_name='Caspase cleavage motif', description='Caspase-3 and Caspase-7 cleavage site.', regex='[DSTE][^P][^DEWHFYC]D[GSAN]', probability='0.00309374033071', n_instances='41', n_pdb='0'), 'CLV_MEL_PAP_1':...(truncated) | 317 | {} | 2022-02-04 00:24:49 | |
| ¶ | pypath.inputs.elm.elm_domains | 2022-02-04 00:24:49 | 2022-02-04 00:24:49 | 0.54 | dict | {'FZR_HUMAN': {'LIG_APCC_Dbox_1': [('218', '471')]}, 'BIRC3_HUMAN': {'LIG_BIR_II_1': [('172', '236')]}} | 2 | {} | 2022-02-04 00:24:49 | |
| ¶ | pypath.inputs.elm.elm_instances | 2022-02-04 00:24:49 | 2022-02-04 00:24:50 | 0.23 | list | [ELMInstance(accession='ELMI003774', type='CLV', identifier='CLV_C14_Caspase3-7', uniprot_id='A0A0H3NIK3_SALTS', uniprot='A0A0H3NIK3', synonyms='A0A0H3NIK3', start='483', end='487', references='20947770', methods='enzymatic reaction; mutation analysis; protease assay; western blot', logic='true posi...(truncated) | 3,934 | {} | 2022-02-04 00:24:49 | |
| ¶ | pypath.inputs.elm.elm_interactions | 2022-02-04 00:24:50 | 2022-02-04 00:26:00 | 70.15 | list | [ELMInteraction(motif_elm='CLV_Separin_Fungi', domain_pfam='PF03568', uniprot_motif='Q12158', uniprot_domain='Q03018', isoform_motif=1, isoform_domain=1, start_motif=175, end_motif=181, start_domain=1171, end_domain=1571, affinity_min=None, affinity_max=None, pubmeds=(10403247, 14585836), taxon_moti...(truncated) | 2,394 | {} | 2022-02-04 00:24:50 | |
| ¶ | pypath.inputs.embrace._embrace_id_translation |
Not calling `pypath.inputs.embrace._embrace_id_translation`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.embrace.embrace_annotations | 2022-02-04 00:26:00 | 2022-02-04 00:26:07 | 7.65 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 162, in embrace_annotations
for rec in embrace_translated(organism = organism):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 92, in embrace_translated
ligands = _embrace_id_translation(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 71, in _embrace_id_translation
uniprots = homology.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 504, in load
self.load_ensembl(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 733, in load_ensembl
ensembl_data = biomart.biomart_homology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:31:20 | |||
| ¶ | pypath.inputs.embrace.embrace_interactions | 2022-02-04 00:26:07 | 2022-02-04 00:26:13 | 5.65 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 128, in embrace_interactions
for rec in embrace_translated(organism = organism)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 92, in embrace_translated
ligands = _embrace_id_translation(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 71, in _embrace_id_translation
uniprots = homology.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 504, in load
self.load_ensembl(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 733, in load_ensembl
ensembl_data = biomart.biomart_homology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:31:24 | |||
| ¶ | pypath.inputs.embrace.embrace_raw | 2022-02-04 00:26:13 | 2022-02-04 00:26:13 | 0.12 | list | [EmbraceRawRecord(ligand_symbol='A2m', receptor_symbol='Lrp1', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=0, N_receptor=1, P_receptor=0, M_receptor=1, EC_receptor=0), EmbraceRawRecord(ligand_symbol='Ace', receptor_symbol='Bdkrb2', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=1, N_receptor=0, P_r...(truncated) | 1,710 | {} | 2022-02-04 00:26:13 | |
| ¶ | pypath.inputs.embrace.embrace_translated | 2022-02-04 00:26:13 | 2022-02-04 00:26:19 | 5.85 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 92, in embrace_translated
ligands = _embrace_id_translation(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/embrace.py", line 71, in _embrace_id_translation
uniprots = homology.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 504, in load
self.load_ensembl(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/homology.py", line 733, in load_ensembl
ensembl_data = biomart.biomart_homology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 202, in biomart_homology
return list(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/biomart.py", line 139, in biomart_query
for line in c.result:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-02-03 00:31:25 | |||
| ¶ | pypath.inputs.encode.encode_tf_mirna_interactions | 2022-02-04 00:26:19 | 2022-02-04 00:26:20 | 0.81 | list | [EncodeInteraction(tf_genesymbol='BDP1', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='RAD21', mirna='hsa-miR-92a-1*'), EncodeInteraction(tf_genesymbol='ESR1', mirna='hsa-miR-23b*'), EncodeInteraction(tf_genesymbol='BCL3', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='HEY1', ...(truncated) | 1,237 | {} | 2022-02-04 00:26:19 | |
| ¶ | pypath.inputs.ensembl.ensembl_organisms | 2022-02-04 00:26:20 | 2022-02-04 00:26:21 | 0.59 | list | [EnsemblOrganism(common_name='Abingdon island giant tortoise', scientific_name='Chelonoidis abingdonii', taxon_id=106734, ensembl_assembly='ASM359739v1', accession='GCA_003597395.1', genebuild_method='Full genebuild', variation_database='-', regulation_database='-', ensembl_name='cabingdonii'), Ense...(truncated) | 311 | {} | 2022-02-04 00:26:20 | |
| ¶ | pypath.inputs.exocarta._get_exocarta_vesiclepedia | 2022-02-04 00:26:21 | 2022-02-04 00:26:31 | 10.52 | list | [('967', 'CD63', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('1803', 'DPP4', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('79574', 'EPS8L3', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('55971', 'BAIAP2L1', 9606, ('11487543', (9606,), 'Intestinal e...(truncated) | 32,085 | {} | 2022-02-04 00:26:21 | |
| ¶ | pypath.inputs.exocarta.get_exocarta | 2022-02-04 00:26:31 | 2022-02-04 00:26:31 | 0.03 | list | [('967', 'CD63', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('1803', 'DPP4', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('79574', 'EPS8L3', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('55971', 'BAIAP2L1', 9606, ('11487543', (9606,), 'Intestinal e...(truncated) | 32,085 | {} | 2022-02-04 00:26:31 | |
| ¶ | pypath.inputs.exocarta.get_vesiclepedia | 2022-02-04 00:26:31 | 2022-02-04 00:27:24 | 53.03 | list | [('31848', 'His3.3B', 9606, ('16342139', (9606,), 'B cells', ('Microparticles',))), ('33736', 'His3.3A', 9606, ('16342139', (9606,), 'B cells', ('Microparticles',))), ('1', 'A1BG', 9606, ('19056867', (9606,), 'Urine', ('Exosomes',))), ('1', 'A1BG', 9606, ('21630462', (9606,), 'Ascites', ('Microvesic...(truncated) | 290,197 | {} | 2022-02-04 00:26:31 | |
| ¶ | pypath.inputs.genecards.genecards_datasheet |
Not calling `pypath.inputs.genecards.genecards_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.genecards.genecards_soup |
Not calling `pypath.inputs.genecards.genecards_soup`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.genecards.genecards_summaries |
Not calling `pypath.inputs.genecards.genecards_summaries`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.get_go_desc |
Not calling `pypath.inputs.go.get_go_desc`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.get_go_quick | 2022-02-04 00:27:24 | 2022-02-04 00:27:24 | 0.35 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 860, in get_go_quick
_ = next(c.result)
TypeError: 'NoneType' object is not an iterator
|
{} | 2022-01-07 23:44:17 | |||
| ¶ | pypath.inputs.go.get_goslim | 2022-02-04 00:27:24 | 2022-02-04 00:27:25 | 0.74 | list | ['GO:0000228', 'GO:0000278', 'GO:0000910', 'GO:0002181', 'GO:0002376', 'GO:0003012', 'GO:0003013', 'GO:0003014', 'GO:0003016', 'GO:0003677', 'GO:0003723', 'GO:0003774', 'GO:0003924', 'GO:0005198', 'GO:0005215', 'GO:0005576', 'GO:0005615', 'GO:0005618', 'GO:0005622', 'GO:0005634', 'GO:0005635', 'GO:0...(truncated) | 143 | {} | 2022-02-04 00:27:24 | |
| ¶ | pypath.inputs.go.go_ancestors_quickgo | 2022-02-04 00:27:25 | 2022-02-04 00:42:08 | 882.95 | dict | {'C': {'GO:0042613': {('GO:0042611', 'is_a')}, 'GO:0032398': {('GO:0042611', 'is_a')}, 'GO:0042612': {('GO:0042611', 'is_a')}, 'GO:0034360': {('GO:0042627', 'is_a')}, 'GO:0034359': {('GO:0042627', 'is_a')}, 'GO:0009426': {('GO:0030694', 'part_of'), ('GO:0110165', 'is_a')}, 'GO:0009429': {('GO:003069...(truncated) | 3 | {} | 2022-02-04 00:27:25 | |
| ¶ | pypath.inputs.go.go_ancestors_goose | 2022-02-04 00:42:08 | 2022-02-04 00:42:11 | 2.95 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 145, in go_ancestors_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:57:44 | |||
| ¶ | pypath.inputs.go.go_ancestors_quickgo | 2022-02-04 00:42:11 | 2022-02-04 00:42:15 | 3.67 | dict | {'C': {'GO:0042613': {('GO:0042611', 'is_a')}, 'GO:0032398': {('GO:0042611', 'is_a')}, 'GO:0042612': {('GO:0042611', 'is_a')}, 'GO:0034360': {('GO:0042627', 'is_a')}, 'GO:0034359': {('GO:0042627', 'is_a')}, 'GO:0009426': {('GO:0030694', 'part_of'), ('GO:0110165', 'is_a')}, 'GO:0009429': {('GO:003069...(truncated) | 3 | {} | 2022-02-04 00:42:11 | |
| ¶ | pypath.inputs.go.go_annotations_goa | 2022-02-04 00:42:15 | 2022-02-04 00:42:17 | 2.12 | dict | {'C': {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6H8': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6H9': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6I0': {'GO:0005886', 'G...(truncated) | 3 | {} | 2022-02-04 00:42:15 | |
| ¶ | pypath.inputs.go.go_annotations_goa | 2022-02-04 00:42:17 | 2022-02-04 00:42:18 | 1.07 | dict | {'C': {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6H8': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6H9': {'GO:0005886', 'GO:0019814', 'GO:0005615'}, 'A0A075B6I0': {'GO:0005886', 'G...(truncated) | 3 | {} | 2022-02-04 00:42:17 | |
| ¶ | pypath.inputs.go.go_annotations_goose | 2022-02-04 00:42:18 | 2022-02-04 00:42:21 | 2.67 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 795, in go_annotations_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:57:55 | |||
| ¶ | pypath.inputs.go.go_annotations_solr | 2022-02-04 00:42:21 | 2022-02-04 00:42:22 | 1.10 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 681, in go_annotations_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
AttributeError: 'Curl' object has no attribute 'fileobj'
|
{} | 2022-01-07 23:57:58 | |||
| ¶ | pypath.inputs.go.go_annotations_uniprot | 2022-02-04 00:42:22 | 2022-02-04 00:42:29 | 7.43 | dict | {'Entry': ['Gene ontology IDs'], 'Q96NG5': ['GO:0000122', 'GO:0000977', 'GO:0000981', 'GO:0001227', 'GO:0005634', 'GO:0006357', 'GO:0046872'], 'Q6ZN19': ['GO:0000978', 'GO:0001228', 'GO:0005634', 'GO:0006357', 'GO:0046872'], 'Q9UI25': [''], 'Q86XN6': ['GO:0000978', 'GO:0000981', 'GO:0005634', 'GO:00...(truncated) | 20,376 | {} | 2022-02-04 00:42:22 | |
| ¶ | pypath.inputs.go.go_descendants_quickgo | 2022-02-04 00:42:30 | 2022-02-04 00:42:33 | 3.49 | dict | {'C': defaultdict(<class 'set'>, {'GO:0042611': {('GO:0042613', 'is_a'), ('GO:0032398', 'is_a'), ('GO:0042612', 'is_a')}, 'GO:0042627': {('GO:0034360', 'is_a'), ('GO:0034359', 'is_a')}, 'GO:0030694': {('GO:0009426', 'part_of'), ('GO:0009429', 'part_of')}, 'GO:0030689': {('GO:0030692', 'is_a'), ('GO:...(truncated) | 3 | {} | 2022-02-04 00:42:30 | |
| ¶ | pypath.inputs.go.go_descendants_goose | 2022-02-04 00:42:33 | 2022-02-04 00:42:36 | 2.59 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 222, in go_descendants_goose
anc = go_ancestors_goose(aspects = aspects)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 145, in go_ancestors_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:58:11 | |||
| ¶ | pypath.inputs.go.go_descendants_quickgo | 2022-02-04 00:42:36 | 2022-02-04 00:42:39 | 3.50 | dict | {'C': defaultdict(<class 'set'>, {'GO:0042611': {('GO:0042613', 'is_a'), ('GO:0032398', 'is_a'), ('GO:0042612', 'is_a')}, 'GO:0042627': {('GO:0034360', 'is_a'), ('GO:0034359', 'is_a')}, 'GO:0030694': {('GO:0009426', 'part_of'), ('GO:0009429', 'part_of')}, 'GO:0030689': {('GO:0030692', 'is_a'), ('GO:...(truncated) | 3 | {} | 2022-02-04 00:42:36 | |
| ¶ | pypath.inputs.go.go_descendants_to_ancestors |
Not calling `pypath.inputs.go.go_descendants_to_ancestors`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.go_terms_quickgo | 2022-02-04 00:42:39 | 2022-02-04 00:42:42 | 2.84 | dict | {'C': {'GO:0042613': 'MHC class II protein complex', 'GO:0042611': 'MHC protein complex', 'GO:0042612': 'MHC class I protein complex', 'GO:0042627': 'chylomicron', 'GO:0042629': 'mast cell granule', 'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:00306...(truncated) | 3 | {} | 2022-02-04 00:42:39 | |
| ¶ | pypath.inputs.go.go_terms_goose | 2022-02-04 00:42:42 | 2022-02-04 00:42:45 | 2.59 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 519, in go_terms_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:58:20 | |||
| ¶ | pypath.inputs.go.go_terms_quickgo | 2022-02-04 00:42:45 | 2022-02-04 00:42:47 | 2.81 | dict | {'C': {'GO:0042613': 'MHC class II protein complex', 'GO:0042611': 'MHC protein complex', 'GO:0042612': 'MHC class I protein complex', 'GO:0042627': 'chylomicron', 'GO:0042629': 'mast cell granule', 'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:00306...(truncated) | 3 | {} | 2022-02-04 00:42:45 | |
| ¶ | pypath.inputs.go.go_terms_solr | 2022-02-04 00:42:47 | 2022-02-04 00:42:48 | 0.63 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/go.py", line 377, in go_terms_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
AttributeError: 'Curl' object has no attribute 'fileobj'
|
{} | 2022-01-07 23:58:26 | |||
| ¶ | pypath.inputs.gpcrdb.gpcrdb_annotations | 2022-02-04 00:42:48 | 2022-02-04 00:42:48 | 0.25 | dict | {'P08908': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28222': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28221': {GpcrdbAnnotati...(truncated) | 402 | {} | 2022-02-04 00:42:48 | |
| ¶ | pypath.inputs.graphviz.graphviz_attrs | 2022-02-04 00:42:48 | 2022-02-04 00:42:49 | 0.91 | tuple | ({'_background': {'type': 'string', 'default': '<none>', 'min': '', 'notes': ''}, 'bb': {'type': 'rect', 'default': '', 'min': '', 'notes': 'write only'}, 'bgcolor': {'type': 'colorcolorList', 'default': '<none>', 'min': '', 'notes': ''}, 'center': {'type': 'bool', 'default': 'false', 'min': '', 'no...(truncated) | 3 | {} | 2022-02-04 00:42:48 | |
| ¶ | pypath.inputs.guide2pharma.guide2pharma_complexes |
Not calling `pypath.inputs.guide2pharma.guide2pharma_complexes`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.guide2pharma.guide2pharma_download | 2022-02-04 00:42:49 | 2022-02-04 00:42:54 | 4.30 | tuple | ([GuideToPharmacologyInteraction(ligand='TNFSF9', ligand_id_type='genesymbol', target='Q07011', target_id_type='uniprot', target_is_ligand=False, ligand_organism=9606, target_organism=9606, effect=0, ligand_location=None, target_type=None, ligand_endogenous=True, pubmed_ids=[]), GuideToPharmacologyI...(truncated) | 2 | {} | 2022-02-04 00:42:49 | |
| ¶ | pypath.inputs.guide2pharma.guide2pharma_interactions |
Not calling `pypath.inputs.guide2pharma.guide2pharma_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.havugimana.get_havugimana | 2022-02-04 00:42:54 | 2022-02-04 00:42:55 | 1.74 | list | [['C_1', '2.0', 'O60547,P30043', 'GMDS_HUMAN,BLVRB_HUMAN', '0.0', 'O60547,P30043,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'Fungi'], ['C_2', '2.0', 'Q92785,Q9NVP1', 'REQU_HUMAN,DDX18_HUMAN', '0.0', 'Q92785,Q9NVP1,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'vertebrates'], ['C_3', '2.0', 'Q...(truncated) | 622 | {} | 2022-02-04 00:42:54 | |
| ¶ | pypath.inputs.havugimana.havugimana_complexes | 2022-02-04 00:42:55 | 2022-02-04 00:42:55 | 0.04 | dict | {'COMPLEX:O60547_P30043': Complex: COMPLEX:O60547_P30043, 'COMPLEX:Q92785_Q9NVP1': Complex: COMPLEX:Q92785_Q9NVP1, 'COMPLEX:O95249_Q86Y82': Complex: COMPLEX:O95249_Q86Y82, 'COMPLEX:P26583_Q9UPN6': Complex: COMPLEX:P26583_Q9UPN6, 'COMPLEX:P15408_P18846': Complex: COMPLEX:P15408_P18846, 'COMPLEX:P2325...(truncated) | 622 | {} | 2022-02-04 00:42:55 | |
| ¶ | pypath.inputs.hgnc.hgnc_genegroups | 2022-02-04 00:42:55 | 2022-02-04 00:43:03 | 8.00 | dict | {'P04217': {HGNCGeneGroupAnnotation(mainclass='Immunoglobulin like domain containing')}, 'Q9NQ94': {HGNCGeneGroupAnnotation(mainclass='RNA binding motif containing')}, 'P01023': {HGNCGeneGroupAnnotation(mainclass='C3 and PZP like, alpha-2-macroglobulin domain containing')}, 'A8K2U0': {HGNCGeneGroupA...(truncated) | 14,986 | {} | 2022-02-04 00:42:55 | |
| ¶ | pypath.inputs.hippie.hippie_interactions | 2022-02-04 00:43:03 | 2022-02-04 00:43:31 | 27.73 | list | [HippieInteraction(id_a='O95644', id_b='Q08209', score=0.9, methods=None, references=('23468591', '24954618', '28514442'), sources=None, organisms=None), HippieInteraction(id_a='P30101', id_b='Q96HE7', score=0.83, methods=None, references=('17170699', '20802462'), sources=None, organisms=None), Hipp...(truncated) | 39,728 | {} | 2022-02-04 00:43:03 | |
| ¶ | pypath.inputs.homologene.get_homologene | 2022-02-04 00:43:31 | 2022-02-04 00:43:31 | 0.04 | list | ['3\t9606\t34\tACADM\t4557231\tNP_000007.1\n', '3\t9598\t469356\tACADM\t160961497\tNP_001104286.1\n', '3\t9544\t705168\tACADM\t109008502\tXP_001101274.1\n', '3\t9615\t490207\tACADM\t545503811\tXP_005622188.1\n', '3\t9913\t505968\tACADM\t115497690\tNP_001068703.1\n', '3\t10090\t11364\tAcadm\t6680618\...(truncated) | 275,237 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.homologene.homologene_dict |
Not calling `pypath.inputs.homologene.homologene_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.homologene.homologene_uniprot_dict |
Not calling `pypath.inputs.homologene.homologene_uniprot_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.hpmr.get_hpmr | 2022-02-04 00:43:31 | 2022-02-04 00:43:31 | 0.01 | dict | {'interactions': [['P26992', 'Receptor', 'P40189', '15051883'], ['P26992', 'Receptor', 'P42702', '15051883'], ['P26992', 'Ligand', 'P00491', '15051883'], ['O75462', 'Receptor', 'P26992', '10966616'], ['O75462', 'Receptor', 'P40189', '10966616'], ['O75462', 'Receptor', 'P42702', '10966616'], ['O75462...(truncated) | 3 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.hpmr.hpmr_annotations | 2022-02-04 00:43:31 | 2022-02-04 00:43:31 | 0.00 | dict | {'P26992': {HPMRAnnotation(role='Receptor', mainclass='Cytokine Type 1 receptors', subclass='CICYTR (Cytokine Type 1 receptors)', subsubclass=None)}, 'P40189': {HPMRAnnotation(role='Receptor', mainclass='Cytokine Type 1 receptors', subclass='OSMR(Cytokine Type 1 receptors)', subsubclass=None)}, 'P42...(truncated) | 1,141 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.hpmr.hpmr_complexes | 2022-02-04 00:43:31 | 2022-02-04 00:43:31 | 0.00 | dict | {} | 0 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.hpmr.hpmr_interactions | 2022-02-04 00:43:31 | 2022-02-04 00:43:31 | 0.00 | list | [['P26992', 'Receptor', 'P40189', '15051883'], ['P26992', 'Receptor', 'P42702', '15051883'], ['P26992', 'Ligand', 'P00491', '15051883'], ['O75462', 'Receptor', 'P26992', '10966616'], ['O75462', 'Receptor', 'P40189', '10966616'], ['O75462', 'Receptor', 'P42702', '10966616'], ['O75462', 'Ligand', 'P26...(truncated) | 619 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.hprd.get_hprd | 2022-02-04 00:43:31 | 2022-02-04 00:43:34 | 3.10 | list | [['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '128', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '91', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '353', 'K', '-', '-', 'Acetylation', ...(truncated) | 86,981 | {} | 2022-02-04 00:43:31 | |
| ¶ | pypath.inputs.hprd.hprd_enzyme_substrate | 2022-02-04 00:43:34 | 2022-02-04 00:43:36 | 1.53 | list | [{'resaa': 'Y', 'resnum': 12, 'typ': 'dephosphorylation', 'references': ['16291744'], 'kinase': 'PTPN1', 'substrate_refseqp': 'NP_001093.1', 'substrate': 'ACTN1', 'start': 5, 'end': 19, 'instance': None}, {'resaa': 'Y', 'resnum': 705, 'typ': 'phosphorylation', 'references': ['11940572', '11294897', ...(truncated) | 4,671 | {} | 2022-02-04 00:43:34 | |
| ¶ | pypath.inputs.hprd.hprd_interactions | 2022-02-04 00:43:36 | 2022-02-04 00:43:38 | 1.61 | list | [['00020', 'ACTN1', '00020_1', 'NP_001093.1', '12', 'Y', 'PTPN1', '01477', 'Dephosphorylation', 'in vitro;in vivo', '16291744'], ['00026', 'STAT3', '00026_1', 'NP_644805.1', '705', 'Y', 'FGFR3', '00624', 'Phosphorylation', 'in vivo', '11940572,11294897,10918587,12244095,11350938,12626508,8626374,125...(truncated) | 4,671 | {} | 2022-02-04 00:43:36 | |
| ¶ | pypath.inputs.hprd.hprd_interactions_htp | 2022-02-04 00:43:38 | 2022-02-04 00:43:39 | 1.50 | list | [['ALDH1A1', '00001', 'NP_000680.2', 'ALDH1A1', '00001', 'NP_000680.2', 'in vivo;yeast 2-hybrid', '12081471,16189514'], ['ITGA7', '02761', 'NP_001138468.1', 'CHRNA1', '00007', 'NP_001034612.1', 'in vivo', '10910772'], ['PPP1R9A', '16000', 'NP_060120.2', 'ACTG1', '00017', 'NP_001605.1', 'in vitro;in ...(truncated) | 39,241 | {} | 2022-02-04 00:43:38 | |
| ¶ | pypath.inputs.htri.htri_interactions | 2022-02-04 00:43:39 | 2022-02-04 00:43:42 | 2.65 | list | [HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='196', genesymbol_tf='AHR...(truncated) | 18,630 | {} | 2022-02-04 00:43:39 | |
| ¶ | pypath.inputs.humancellmap.humancellmap_annotations | 2022-02-04 00:43:42 | 2022-02-04 00:43:43 | 1.42 | dict | {'Q9NRG9': {HumancellmapAnnotation(localization='nuclear outer membrane-ER membrane network', method='SAFE'), HumancellmapAnnotation(localization='peroxisome', method='NMF'), HumancellmapAnnotation(localization='mitochondrial outer membrane', method='NMF')}, 'Q2M2I8': {HumancellmapAnnotation(localiz...(truncated) | 4,371 | {} | 2022-02-04 00:43:42 | |
| ¶ | pypath.inputs.humap.humap2_complexes | 2022-02-04 00:43:43 | 2022-02-04 00:43:45 | 2.08 | dict | {'COMPLEX:O95900_Q9BQS8': Complex: COMPLEX:O95900_Q9BQS8, 'COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9': Complex: COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9, 'COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6ZRY4_Q93062_Q96S66_Q9NZC3_Q9UF11_Q9Y6M7': Complex: COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6Z...(truncated) | 6,943 | {} | 2022-02-04 00:43:43 | |
| ¶ | pypath.inputs.humap.humap_complexes | 2022-02-04 00:43:45 | 2022-02-04 00:43:47 | 1.47 | dict | {'COMPLEX:Q7L523_Q8NBW4_Q9HB90': Complex: COMPLEX:Q7L523_Q8NBW4_Q9HB90, 'COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3': Complex: COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3, 'COMPLEX:P31942_Q32P51': Complex: COMPLEX:P31942_Q32P51, 'COMPLEX:P35606_Q9NTJ5_Q9UBF2': Complex: COM...(truncated) | 4,495 | {} | 2022-02-04 00:43:45 | |
| ¶ | pypath.inputs.huri._huri_interactions |
Not calling `pypath.inputs.huri._huri_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.huri.hi_i_interactions | 2022-02-04 00:43:47 | 2022-02-04 00:43:49 | 2.04 | list | [HuriInteraction(uniprot_a='Q8IY31', uniprot_b='Q9BQD3', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='P49902', uniprot_b='P49902', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q9BVJ6', uniprot_b='Q8NHQ1', isoform_a=1, isoform_b=1, score=None), HuriInteractio...(truncated) | 5,676 | {} | 2022-02-04 00:43:47 | |
| ¶ | pypath.inputs.huri.hi_ii_interactions | 2022-02-04 00:43:49 | 2022-02-04 00:43:59 | 10.02 | list | [HuriInteraction(uniprot_a='Q9H2A7', uniprot_b='Q6UY14', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q5SY16', uniprot_b='Q09666', isoform_a=1, isoform_b=2, score=None), HuriInteraction(uniprot_a='P59797', uniprot_b='Q8NF64', isoform_a=1, isoform_b=3, score=None), HuriInteractio...(truncated) | 46,898 | {} | 2022-02-04 00:43:49 | |
| ¶ | pypath.inputs.huri.hi_iii_old | 2022-02-04 00:43:59 | 2022-02-04 00:43:59 | 0.00 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 784, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/huri.py", line 94, in hi_iii_old
url = urls.urls['hid']['hi-iii']
KeyError: 'hi-iii'
|
{} | 2022-01-08 00:02:33 | |||
| ¶ | pypath.inputs.huri.hi_union_interactions | 2022-02-04 00:43:59 | 2022-02-04 00:44:46 | 47.58 | list | [HuriInteraction(uniprot_a='P0DP25', uniprot_b='Q9H0B3', isoform_a=1, isoform_b=1, score=0.899116271005), HuriInteraction(uniprot_a='Q68D86', uniprot_b='Q9HD26', isoform_a=1, isoform_b=2, score=0.83445807946), HuriInteraction(uniprot_a='Q13515', uniprot_b='Q9UJW9', isoform_a=1, isoform_b=1, score=0....(truncated) | 231,004 | {} | 2022-02-04 00:43:59 | |
| ¶ | pypath.inputs.huri.huri_interactions | 2022-02-04 00:44:46 | 2022-02-04 00:45:22 | 35.24 | list | [HuriInteraction(uniprot_a='P0DP25', uniprot_b='Q9H0B3', isoform_a=1, isoform_b=1, score=0.899116271005), HuriInteraction(uniprot_a='Q68D86', uniprot_b='Q9HD26', isoform_a=1, isoform_b=2, score=0.83445807946), HuriInteraction(uniprot_a='Q13515', uniprot_b='Q9UJW9', isoform_a=1, isoform_b=1, score=0....(truncated) | 167,638 | {} | 2022-02-04 00:44:46 | |
| ¶ | pypath.inputs.huri.lit_bm_13_interactions | 2022-02-04 00:45:22 | 2022-02-04 00:45:23 | 0.93 | list | [LitBm13Interaction(entrez_a='4790', entrez_b='79155', genesymbol_a='NFKB1', genesymbol_b='TNIP2'), LitBm13Interaction(entrez_a='7879', entrez_b='83547', genesymbol_a='RAB7A', genesymbol_b='RILP'), LitBm13Interaction(entrez_a='3932', entrez_b='80306', genesymbol_a='LCK', genesymbol_b='MED28'), LitBm...(truncated) | 11,045 | {} | 2022-02-04 00:45:22 | |
| ¶ | pypath.inputs.huri.lit_bm_17_interactions | 2022-02-04 00:45:23 | 2022-02-04 00:45:24 | 1.11 | list | [LitBm17Interaction(id_a='P07359', id_b='P13224', pubmed='18789323', score=0.659), LitBm17Interaction(id_a='P07359', id_b='P13224', pubmed='18674540', score=0.659), LitBm17Interaction(id_a='P63104', id_b='P13224', pubmed='10627461', score=0.702), LitBm17Interaction(id_a='P63104', id_b='P13224', pubm...(truncated) | 48,796 | {} | 2022-02-04 00:45:23 | |
| ¶ | pypath.inputs.huri.lit_bm_interactions | 2022-02-04 00:45:24 | 2022-02-04 00:46:55 | 91.64 | list | [LitBmInteraction(uniprot_a='P23511', uniprot_b='Q13952'), LitBmInteraction(uniprot_a='P23511', uniprot_b='P25208'), LitBmInteraction(uniprot_a='P43351', uniprot_b='P43351'), LitBmInteraction(uniprot_a='Q92934', uniprot_b='Q92843'), LitBmInteraction(uniprot_a='Q92934', uniprot_b='Q07817'), LitBmInte...(truncated) | 13,675 | {} | 2022-02-04 00:45:24 | |
| ¶ | pypath.inputs.huri.rolland_hi_ii_14 | 2022-02-04 00:46:55 | 2022-02-04 00:46:58 | 2.82 | list | [['14', '6293', 'AAMP', 'VPS52', '1'], ['14', '8553', 'AAMP', 'BHLHE40', '1'], ['14', '64782', 'AAMP', 'AEN', '2'], ['15', '4188', 'AANAT', 'MDFI', '1'], ['15', '8553', 'AANAT', 'BHLHE40', '1'], ['28', '65983', 'ABO', 'GRAMD3', '2'], ['28', '84283', 'ABO', 'TMEM79', '1'], ['39', '39', 'ACAT2', 'ACAT...(truncated) | 13,944 | {} | 2022-02-04 00:46:55 | |
| ¶ | pypath.inputs.huri.vidal_hi_iii_old |
Not calling `pypath.inputs.huri.vidal_hi_iii_old`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.huri.yang2016_interactions | 2022-02-04 00:46:58 | 2022-02-04 00:47:00 | 1.60 | list | [HuriInteraction(uniprot_a='P07196', uniprot_b='Q9BQQ3', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='O94989', uniprot_b='Q53EZ4', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q8NHQ1', uniprot_b='Q9H7H0', isoform_a=1, isoform_b=1, score=None), HuriInteractio...(truncated) | 2,829 | {} | 2022-02-04 00:46:58 | |
| ¶ | pypath.inputs.huri.yu2011_interactions | 2022-02-04 00:47:00 | 2022-02-04 00:47:03 | 2.94 | list | [HuriInteraction(uniprot_a='Q5VUM1', uniprot_b='O43889', isoform_a=1, isoform_b=2, score=None), HuriInteraction(uniprot_a='P62166', uniprot_b='Q86UW9', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q9NV12', uniprot_b='O43889', isoform_a=1, isoform_b=2, score=None), HuriInteractio...(truncated) | 7,381 | {} | 2022-02-04 00:47:00 | |
| ¶ | pypath.inputs.i3d.get_i3d | 2022-02-04 00:47:03 | 2022-02-04 00:47:08 | 4.95 | list | [{'A0A024RAV5': {'pfam': None, 'chain': 'B', 'seq': [[1, 185]]}, 'P02647': {'pfam': None, 'chain': 'A', 'seq': [[68, 265]]}, 'uniprots': ['A0A024RAV5', 'P02647'], 'source': 'I3D', 'pdb': ['2mse'], 'references': []}, {'A0A024RAV5': {'pfam': None, 'chain': 'B', 'seq': [[1, 185]]}, 'P10398': {'pfam': N...(truncated) | 15,984 | {} | 2022-02-04 00:47:03 | |
| ¶ | pypath.inputs.icellnet._icellnet_get_components |
Not calling `pypath.inputs.icellnet._icellnet_get_components`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_entity |
Not calling `pypath.inputs.icellnet._icellnet_get_entity`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_references |
Not calling `pypath.inputs.icellnet._icellnet_get_references`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_resources |
Not calling `pypath.inputs.icellnet._icellnet_get_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet.icellnet_annotations | 2022-02-04 00:47:08 | 2022-02-04 00:47:08 | 0.33 | dict | {'P03971': {IcellnetAnnotation(role='ligand', family='Cytokine', subfamily=None, classification=('Cytokine', 'Tgf'))}, Complex: COMPLEX:P36894_Q16671: {IcellnetAnnotation(role='receptor', family='Cytokine', subfamily=None, classification=('Cytokine', 'Tgf'))}, 'P36894': {IcellnetAnnotation(role='rec...(truncated) | 688 | {} | 2022-02-04 00:47:08 | |
| ¶ | pypath.inputs.icellnet.icellnet_complexes | 2022-02-04 00:47:08 | 2022-02-04 00:47:08 | 0.10 | dict | {'COMPLEX:P36894_Q16671': Complex: COMPLEX:P36894_Q16671, 'COMPLEX:Q04771_Q16671': Complex: COMPLEX:Q04771_Q16671, 'COMPLEX:P27037_P37023': Complex: COMPLEX:P27037_P37023, 'COMPLEX:P37023_Q13705': Complex: COMPLEX:P37023_Q13705, 'COMPLEX:P37023_Q13873': Complex: COMPLEX:P37023_Q13873, 'COMPLEX:O0023...(truncated) | 117 | {} | 2022-02-04 00:47:08 | |
| ¶ | pypath.inputs.icellnet.icellnet_interactions | 2022-02-04 00:47:08 | 2022-02-04 00:47:08 | 0.09 | list | [IcellnetRecord(ligand='P03971', receptor=Complex: COMPLEX:P36894_Q16671, family='Cytokine', subfamily=None, classification=['Cytokine', 'Tgf'], resources=None, references=['32333774']), IcellnetRecord(ligand='P03971', receptor=Complex: COMPLEX:Q04771_Q16671, family='Cytokine', subfamily=None, class...(truncated) | 743 | {} | 2022-02-04 00:47:08 | |
| ¶ | pypath.inputs.ielm.get_ielm |
Not calling `pypath.inputs.ielm.get_ielm`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ielm.get_ielm_huge |
Not calling `pypath.inputs.ielm.get_ielm_huge`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.imweb._get_imweb | 2022-02-04 00:47:08 | 2022-02-04 00:47:10 | 1.61 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/imweb.py", line 76, in _get_imweb
hdrs.append('Cookie: access-token=%s' % json.loads(c0.result)['token'])
File "/usr/lib/python3.9/json/__init__.py", line 339, in loads
raise TypeError(f'the JSON object must be str, bytes or bytearray, '
TypeError: the JSON object must be str, bytes or bytearray, not NoneType
|
{} | 2022-01-08 00:05:26 | |||
| ¶ | pypath.inputs.imweb.get_imweb | 2022-02-04 00:47:10 | 2022-02-04 00:47:10 | 0.09 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/imweb.py", line 115, in get_imweb
token = json.loads(fp.read())['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-01-08 00:05:27 | |||
| ¶ | pypath.inputs.imweb.get_imweb_req | 2022-02-04 00:47:10 | 2022-02-04 00:47:11 | 0.58 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/imweb.py", line 142, in get_imweb_req
token = json.loads(r0.text)['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-01-08 00:05:27 | |||
| ¶ | pypath.inputs.innatedb.innatedb_interactions | 2022-02-04 00:47:11 | 2022-02-04 00:47:13 | 2.14 | list | [InnatedbInteraction(source_uniprot='Q9Y6Y9', source_genesymbol='LY96', target_uniprot='O00206', target_genesymbol='TLR4', pmid='10359581'), InnatedbInteraction(source_uniprot='Q99836', source_genesymbol='MYD88', target_uniprot='O00206', target_genesymbol='TLR4', pmid='17228323'), InnatedbInteractio...(truncated) | 19,036 | {} | 2022-02-04 00:47:11 | |
| ¶ | pypath.inputs.instruct.get_instruct | 2022-02-04 00:47:13 | 2022-02-04 00:47:15 | 1.95 | list | [{'Q05513': {'pfam': 'PF00069', 'chain': None, 'seq': [['252', '518']]}, 'uniprots': ['Q05513', 'Q05513'], 'source': 'Instruct', 'pdb': ['3pfq'], 'references': ['11078718', '15665819', '17203073', '18650932', '19920073', '21900206', '21911421', '9748166']}, {'P01106': {'pfam': 'PF02344', 'chain': No...(truncated) | 11,470 | {} | 2022-02-04 00:47:13 | |
| ¶ | pypath.inputs.instruct.get_instruct_offsets | 2022-02-04 00:47:15 | 2022-02-04 00:47:15 | 0.50 | dict | {('10gs', 'P09211'): 0, ('11gs', 'P09211'): 0, ('12gs', 'P09211'): 0, ('13gs', 'P09211'): 0, ('14gs', 'P09211'): 0, ('16gs', 'P09211'): 0, ('17gs', 'P09211'): 0, ('18gs', 'P09211'): 0, ('19gs', 'P09211'): 0, ('1a00', 'P68871'): 0, ('1a00', 'P69905'): 0, ('1a01', 'P68871'): 0, ('1a01', 'P69905'): 0, ...(truncated) | 11,620 | {} | 2022-02-04 00:47:15 | |
| ¶ | pypath.inputs.intact._try_isoform |
Not calling `pypath.inputs.intact._try_isoform`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.intact.intact_interactions | 2022-02-04 00:47:15 | 2022-02-04 00:48:19 | 63.23 | list | [IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', id_type_b='uniprot', pubmeds={'10542231'}, methods={'peptide array'}, mi_score='0.77', isoform_a=None, isoform_b=None), IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', id_type_b='uniprot', pubmeds={'10542231'}...(truncated) | 70,176 | {} | 2022-02-04 00:47:15 | |
| ¶ | pypath.inputs.integrins.get_integrins | 2022-02-04 00:48:19 | 2022-02-04 00:48:20 | 1.00 | set | {'P23229', 'P08514', 'Q9UKX5', 'P18084', 'P08648', 'P05107', 'P16144', 'P20702', 'P05556', 'P26012', 'P53708', 'P11215', 'P05106', 'P17301', 'P20701', 'P26006', 'Q13797', 'Q13683', 'P38570', 'P56199', 'P18564', 'O75578', 'Q13349', 'P06756', 'P26010'} | 25 | {} | 2022-02-04 00:48:19 | |
| ¶ | pypath.inputs.intogen.intogen_annotations | 2022-02-04 00:48:20 | 2022-02-04 00:48:20 | 0.78 | dict | {'P00519': {IntogenAnnotation(type='FUSION', role='Activating', curated=False, oncodrive_role_prob=nan)}, 'P42684': {IntogenAnnotation(type='MUTATION', role='Activating', curated=False, oncodrive_role_prob=0.811)}, 'Q13085': {IntogenAnnotation(type='MUTATION', role='Activating', curated=False, oncod...(truncated) | 480 | {} | 2022-02-04 00:48:20 | |
| ¶ | pypath.inputs.ipi._ipi_uniprot_pairs |
Not calling `pypath.inputs.ipi._ipi_uniprot_pairs`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ipi.ipi_uniprot | 2022-02-04 00:48:20 | 2022-02-04 00:48:21 | 0.30 | dict | {'IPI00807623': {'A0A183'}, 'IPI00396341': {'A0AUZ9'}, 'IPI00884975': {'A0AUZ9'}, 'IPI00884987': {'A0AUZ9'}, 'IPI00885003': {'A0AUZ9'}, 'IPI00855723': {'A0AV02'}, 'IPI00867607': {'A0AV02'}, 'IPI00793608': {'A0AV02'}, 'IPI00867726': {'A0AV02'}, 'IPI00867740': {'A0AV02'}, 'IPI00169342': {'A0AV96'}, 'I...(truncated) | 51,106 | {} | 2022-02-04 00:48:20 | |
| ¶ | pypath.inputs.iptmnet.iptmnet_interactions | 2022-02-04 00:48:21 | 2022-02-04 00:48:38 | 17.53 | list | [IptmnetInteraction(enzyme='Q92793', substrate='O15265', enzyme_isoform=None, substrate_isoform=1, ptm_type='acetylation', resaa='257', resnum='K', score=None, references=['19955365']), IptmnetInteraction(enzyme='Q09472', substrate='O15527', enzyme_isoform=None, substrate_isoform=1, ptm_type='acetyl...(truncated) | 16,686 | {} | 2022-02-04 00:48:21 | |
| ¶ | pypath.inputs.italk.italk_annotations | 2022-02-04 00:48:38 | 2022-02-04 00:48:39 | 0.77 | dict | {'P01023': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'Q07954': {ItalkAnnotation(mainclass='receptor', subclass='other'), ItalkAnnotation(mainclass='receptor', subclass='growth factor')}, 'Q16613': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'P48039': {ItalkAnnotation(main...(truncated) | 1,414 | {} | 2022-02-04 00:48:38 | |
| ¶ | pypath.inputs.italk.italk_interactions | 2022-02-04 00:48:39 | 2022-02-04 00:48:39 | 0.19 | list | [ItalkInteraction(ligand='P01023', receptor='Q07954', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P48039', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P49286', classification='other'), ItalkInteraction(ligand='P12821', receptor='P50052', classificati...(truncated) | 2,706 | {} | 2022-02-04 00:48:39 | |
| ¶ | pypath.inputs.italk.italk_raw | 2022-02-04 00:48:39 | 2022-02-04 00:48:39 | 0.01 | DataFrame | Pair.Name ... Classification 0 A2M_LRP1 ... other 1 AANAT_MTNR1A ... other 2 AANAT_MTNR1B ... other 3 ACE_AGTR2 ... other 4 ACE_BDKRB2 ... other ... ... ... ... 2644 CXCL8_KSHV ...(truncated) | 2,649 | {} | 2022-02-04 00:48:39 | |
| ¶ | pypath.inputs.kea.kea_enzyme_substrate | 2022-02-04 00:48:39 | 2022-02-04 00:48:44 | 4.68 | list | [{'start': None, 'end': None, 'instance': None, 'substrate': 'P08581', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 1349, 'references': {'15475459'}, 'typ': 'phosphorylation'}, {'start': None, 'end': None, 'instance': None, 'substrate': 'P98161', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 432, 'refe...(truncated) | 35,196 | {} | 2022-02-04 00:48:39 | |
| ¶ | pypath.inputs.kea.kea_interactions | 2022-02-04 00:48:44 | 2022-02-04 00:48:47 | 2.66 | list | [KeaRecord(enzyme='P00519', substrate='P08581', residue_type='Y', residue_offset=1349, pmid='15475459', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', residue_type='Y', residue_offset=432, pmid='12637538', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', resid...(truncated) | 35,196 | {} | 2022-02-04 00:48:44 | |
| ¶ | pypath.inputs.kegg.kegg_dbget |
Not calling `pypath.inputs.kegg.kegg_dbget`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.kegg.kegg_interactions | 2022-02-04 00:48:47 | 2022-02-04 00:50:55 | 127.83 | list | [KeggInteraction(id_a='Q03113', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcriptional=False), KeggInteraction(id_a='O94763', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcription...(truncated) | 14,425 | {} | 2022-02-04 00:48:47 | |
| ¶ | pypath.inputs.kegg.kegg_medicus | 2022-02-04 00:50:55 | 2022-02-04 00:51:08 | 13.74 | set | {KeggMedicusRawInteraction(id_a='C20304', id_b='C14874', name_a='S-(2-Chloroethyl)glutathione', name_b='Glutathione episulfonium ion', effect='stimulation', itype='post_translational', pw_type='factor', type_a='metabolite', type_b='metabolite', network_id='N01386'), KeggMedicusRawInteraction(id_a='5...(truncated) | 12,601 | {} | 2022-02-04 00:50:55 | |
| ¶ | pypath.inputs.kegg.kegg_medicus_complexes | 2022-02-04 00:51:08 | 2022-02-04 00:51:10 | 1.63 | dict | {'COMPLEX:P24390_P49755_Q15363': Complex: COMPLEX:P24390_P49755_Q15363, 'COMPLEX:O15553_Q9ULZ3': Complex: COMPLEX:O15553_Q9ULZ3, 'COMPLEX:P01031_P02748_P07358_P10643_P13671': Complex: COMPLEX:P01031_P02748_P07358_P10643_P13671, 'COMPLEX:Q14118_Q9NSN8_Q9Y4J8': Complex: COMPLEX:Q14118_Q9NSN8_Q9Y4J8, '...(truncated) | 267 | {} | 2022-02-04 00:51:08 | |
| ¶ | pypath.inputs.kegg.kegg_medicus_interactions | 2022-02-04 00:51:10 | 2022-02-04 00:51:11 | 1.40 | list | [KeggMedicusInteraction(id_a='P09619', id_b='P62993', entity_type_a='protein', entity_type_b='protein', interaction_type='post_translational', effect='stimulation'), KeggMedicusInteraction(id_a=Complex: COMPLEX:P06681_P0C0L4, id_b='P01024', entity_type_a='complex', entity_type_b='protein', interacti...(truncated) | 9,383 | {} | 2022-02-04 00:51:10 | |
| ¶ | pypath.inputs.kegg.kegg_pathway_annotations | 2022-02-04 00:51:11 | 2022-02-04 00:51:18 | 6.91 | dict | {'P48023': {KeggPathway(pathway='Necroptosis'), KeggPathway(pathway='MAPK signaling pathway'), KeggPathway(pathway='Alcoholic liver disease'), KeggPathway(pathway='Allograft rejection'), KeggPathway(pathway='Lipid and atherosclerosis'), KeggPathway(pathway='Apoptosis'), KeggPathway(pathway='Autoimmu...(truncated) | 2,567 | {} | 2022-02-04 00:51:11 | |
| ¶ | pypath.inputs.kegg.kegg_pathway_annotations_pathwaycommons | 2022-02-04 00:51:18 | 2022-02-04 00:51:19 | 0.42 | dict | {'A8K7J7': {KeggPathway(pathway='Fructose and mannose metabolism'), KeggPathway(pathway='Starch and sucrose metabolism'), KeggPathway(pathway='Metabolic pathways'), KeggPathway(pathway='Butirosin and neomycin biosynthesis'), KeggPathway(pathway='Galactose metabolism'), KeggPathway(pathway='Glycolysi...(truncated) | 813 | {} | 2022-02-04 00:51:18 | |
| ¶ | pypath.inputs.kegg.kegg_pathways | 2022-02-04 00:51:19 | 2022-02-04 00:51:25 | 6.67 | tuple | ({'MAPK signaling pathway': {'P48023', 'P15976', 'P63000', 'Q9HBH9', 'P49407', 'Q9Y3M2', 'P04637', 'P41279', 'P45985', 'O15111', 'Q07889', 'Q9Y2U5', 'P01583', 'Q16644', 'Q9Y4K3', 'O75676', 'Q9BQ95', 'O95819', 'P51452', 'P35557', 'P52564', 'P28482', 'Q9Y6W6', 'P17535', 'O75608', 'P49116', 'Q9UER7', '...(truncated) | 2 | {} | 2022-02-04 00:51:19 | |
| ¶ | pypath.inputs.kinasedotcom.kinasedotcom_annotations | 2022-02-04 00:51:25 | 2022-02-04 00:51:31 | 5.79 | dict | {'P31749': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'P31751': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'Q9Y243': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'O14578': {KinasedotcomAnnotation(group='AGC', family='DMPK', ...(truncated) | 503 | {} | 2022-02-04 00:51:25 | |
| ¶ | pypath.inputs.kirouac2010.kirouac2010_interactions | 2022-02-04 00:51:31 | 2022-02-04 00:51:35 | 3.81 | list | [Kiruac2010Interaction(ligand='ADIPOQ', receptor='ADIPOR'), Kiruac2010Interaction(ligand='AGRP', receptor='ATRN'), Kiruac2010Interaction(ligand='AREG', receptor='EGFR'), Kiruac2010Interaction(ligand='ANGPTL1', receptor='TEK'), Kiruac2010Interaction(ligand='ANGPTL2', receptor='TEK'), Kiruac2010Intera...(truncated) | 267 | {} | 2022-02-04 00:51:31 | |
| ¶ | pypath.inputs.laudanna.laudanna_directions | 2022-02-04 00:51:35 | 2022-02-04 00:51:35 | 0.38 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/laudanna.py", line 56, in laudanna_directions
LaudannaDirection(
TypeError: <lambda>() missing 1 required positional argument: 'target_genesymbol'
|
{} | 2022-01-08 00:09:37 | |||
| ¶ | pypath.inputs.laudanna.laudanna_effects | 2022-02-04 00:51:35 | 2022-02-04 00:51:36 | 0.63 | list | [LaudannaEffect(source_genesymbol='EDNRA', target_genesymbol='NBN', effect='activation'), LaudannaEffect(source_genesymbol='TGFB1', target_genesymbol='TGFB1', effect='inhibition'), LaudannaEffect(source_genesymbol='EIF5B', target_genesymbol='RPL11', effect='activation'), LaudannaEffect(source_genesy...(truncated) | 63,438 | {} | 2022-02-04 00:51:35 | |
| ¶ | pypath.inputs.li2012.get_li2012 | 2022-02-04 00:51:36 | 2022-02-04 00:52:00 | 23.80 | list | [['BCR', 'BCR/177', 'ABL', 'PTPN SH2', 'CTK_Cytoplasm', 'ubiquitous', 'PPP'], ['BCR', 'BCR/177', 'ABL', 'GRB2 SH2', 'CTK_Cytoplasm', 'ubiquitous', 'PPP'], ['CAV', 'CAV1/14', 'ABL', 'GRB7 SH2', 'CTK_Membrane', 'ubiquitous', 'PPP'], ['CBL', 'CBL/700', 'ABL', 'CRK SH2', 'CTK_Cytoplasm', 'ubiquitous', '...(truncated) | 583 | {} | 2022-02-04 00:51:36 | |
| ¶ | pypath.inputs.li2012.li2012_dmi | 2022-02-04 00:52:00 | 2022-02-04 00:52:08 | 8.22 | list | [<ABL1 => Residue BCR-1:Y177:phosphorylation ['Li2012']>, <ABL1 => Residue BCR-1:Y177:phosphorylation ['Li2012']>, <ABL1 => Residue CAV1-1:Y14:phosphorylation ['Li2012']>, <ABL1 => Residue CBL-1:Y700:phosphorylation ['Li2012']>, <ABL1 => Residue CBL-1:Y700:phosphorylation ['Li2012']>, <ABL1 => Resid...(truncated) | 593 | {} | 2022-02-04 00:52:00 | |
| ¶ | pypath.inputs.li2012.li2012_enzyme_substrate | 2022-02-04 00:52:08 | 2022-02-04 00:52:08 | 0.03 | list | [{'substrate': 'BCR', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 177}, {'substrate': 'CAV1', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 14}, {'substrate': 'CBL', 'kinase': 'ABL', 'instance': None, 'start': None, ...(truncated) | 349 | {} | 2022-02-04 00:52:08 | |
| ¶ | pypath.inputs.li2012.li2012_interactions | 2022-02-04 00:52:08 | 2022-02-04 00:52:08 | 0.03 | list | [['ABL', 'BCR', 'CTK_Cytoplasm', 'phosphorylation'], ['BCR', 'PTPN', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['BCR', 'GRB2', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['ABL', 'CAV1', 'CTK_Membrane', 'phosphorylation'], ['CAV1', 'GRB7', 'CTK_Membrane', 'phosphomotif_binding'], ['ABL', 'CBL', 'CTK_C...(truncated) | 503 | {} | 2022-02-04 00:52:08 | |
| ¶ | pypath.inputs.lincs.lincs_compounds | 2022-02-04 00:52:08 | 2022-02-04 00:52:12 | 3.97 | dict | {'10001': LincsCompound(lincs='LSM-1001', chembl='CHEMBL14762', chebi='CHEBI:354.22', inchi='InChI=1S/C19H26N6O/c1-4-15(11-26)22-19-23-17(20-10-14-8-6-5-7-9-14)16-18(24-19)25(12-21-16)13(2)3/h5-9,12-13,15,26H,4,10-11H2,1-3H3,(H2,20,22,23,24)/t15-/m1/s1', inchi_key='BTIHMVBBUGXLCJ-OAHLLOKOSA-N', smil...(truncated) | 1,320 | {} | 2022-02-04 00:52:08 | |
| ¶ | pypath.inputs.lmpid.lmpid_dmi | 2022-02-04 00:52:12 | 2022-02-04 00:52:13 | 1.11 | list | [{'motif_protein': 'P54253', 'domain_protein': 'P62258', 'instance': 'RRWSAP', 'motif_start': 772, 'motif_end': 777, 'domain_name': '14-3-3 domain', 'domain_name_type': 'name', 'refs': ['20037628', '12757707']}, {'motif_protein': 'P54253', 'domain_protein': 'P63104', 'instance': 'RRWSAP', 'motif_sta...(truncated) | 1,170 | {} | 2022-02-04 00:52:12 | |
| ¶ | pypath.inputs.lmpid.lmpid_interactions | 2022-02-04 00:52:13 | 2022-02-04 00:52:14 | 0.65 | list | [['P62258', 'P54253', '20037628;12757707'], ['P63104', 'P54253', '20037628;12757707'], ['P63104', 'P04049', '8601312'], ['P27348', 'P04049', '8601312'], ['P31946', 'P04049', '8601312'], ['Q04917', 'P04049', '8601312'], ['P63104', 'Q99683', '10411906'], ['P63104', 'P98177', '14690436'], ['P62258', 'O...(truncated) | 1,170 | {} | 2022-02-04 00:52:13 | |
| ¶ | pypath.inputs.lmpid.load_lmpid | 2022-02-04 00:52:14 | 2022-02-04 00:52:15 | 0.91 | list | [{'bait': 'P54253', 'prey': 'P62258', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P54253', 'prey': 'P63104', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P04049', 'prey': 'P6310...(truncated) | 1,170 | {} | 2022-02-04 00:52:14 | |
| ¶ | pypath.inputs.lncdisease.lncdisease_interactions | 2022-02-04 00:52:15 | 2022-02-04 00:52:15 | 0.21 | list | [LncdiseaseInteraction(source='7SK', target='ABO', source_type='RNA', target_type='RNA', mechanism='regulatory', organism='human', pmid='22522162'), LncdiseaseInteraction(source='7SK', target='Ars2', source_type='RNA', target_type='Protein', mechanism='regulatory', organism='human', pmid='22244333')...(truncated) | 478 | {} | 2022-02-04 00:52:15 | |
| ¶ | pypath.inputs.lncrnadb.lncrnadb_interactions | 2022-02-04 00:52:15 | 2022-02-04 00:52:15 | 0.48 | list | [LncrnadbInteraction(lncrna='Maternal somatic nucleus RNAs', partner='Scan RNAs', type='transcript', organism='Paramecium tetraurelia', pmid='19103667'), LncrnadbInteraction(lncrna='G22', partner='PABP', type='protein', organism='Loris tardigradus', pmid='17175535'), LncrnadbInteraction(lncrna='G22'...(truncated) | 773 | {} | 2022-02-04 00:52:15 | |
| ¶ | pypath.inputs.locate.locate_localizations | 2022-02-04 00:52:15 | 2022-02-04 00:52:51 | 35.95 | dict | {'P27824': {LocateAnnotation(source='HPRD', location='nuclear envelope', cls='typeI', pmid=None, score=None), LocateAnnotation(source='HPRD', location='lysosomes', cls='typeI', pmid=None, score=None), LocateAnnotation(source='UniProt/SPTrEMBL', location='melanosome', cls='typeI', pmid=None, score=No...(truncated) | 9,494 | {} | 2022-02-04 00:52:15 | |
| ¶ | pypath.inputs.lrdb.lrdb_annotations | 2022-02-04 00:52:51 | 2022-02-04 00:52:52 | 0.73 | dict | {'P01023': {LrdbAnnotation(role='ligand', cell_type=None, sources=('Fantom5', 'HPMR', 'HPRD'), references=('10652313',))}, 'Q07954': {LrdbAnnotation(role='receptor', cell_type=None, sources=('Fantom5', 'HPMR', 'HPRD'), references=('151', '8626456')), LrdbAnnotation(role='receptor', cell_type=None, s...(truncated) | 1,536 | {} | 2022-02-04 00:52:51 | |
| ¶ | pypath.inputs.lrdb.lrdb_interactions | 2022-02-04 00:52:52 | 2022-02-04 00:52:52 | 0.04 | list | [LrdbRecord(ligand_genesymbol='A2M', receptor_genesymbol='LRP1', sources=['Fantom5', 'HPMR', 'HPRD'], references=['10652313'], ligand_cells=[], receptor_cells=[]), LrdbRecord(ligand_genesymbol='AANAT', receptor_genesymbol='MTNR1A', sources=['Fantom5', 'HPMR'], references=['12943195'], ligand_cells=[...(truncated) | 3,251 | {} | 2022-02-04 00:52:52 | |
| ¶ | pypath.inputs.macrophage._trim_gname |
Not calling `pypath.inputs.macrophage._trim_gname`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.macrophage.macrophage_interactions | 2022-02-04 00:52:52 | 2022-02-04 00:52:52 | 0.21 | list | [MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16497931'), MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16965765'), Macro...(truncated) | 4,516 | {} | 2022-02-04 00:52:52 | |
| ¶ | pypath.inputs.matrisome.__matrisome_annotations_2 | 2022-02-04 00:52:52 | 2022-02-04 00:53:08 | 15.31 | set | {'TNC', 'Fbn2', 'CTSA', 'CSPG5', 'PZP', 'COL4A5', 'Plod3', 'Serpind1', 'FAM20B', 'LTBP1', 'PF4V1', 'LMAN1', 'F13b', 'Mep1a', 'GPC6', 'FGL2', 'REG4', 'CHADL', 'SERPINA10', 'NRG2', 'PLXNC1', 'Col17a1', 'Gpc4', 'Vcan', 'LEFTY1', 'Thbs3', 'COL19A1', 'CHRDL2', 'MMP2', 'Pzp', 'Serpine2', 'MGP', 'C1QA', 'C...(truncated) | 744 | {} | 2022-02-04 00:52:52 | |
| ¶ | pypath.inputs.matrisome.matrisome_annotations | 2022-02-04 00:53:08 | 2022-02-04 00:53:08 | 0.71 | dict | {'Q7Z7G0': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'B4DSV9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'Q5JPC9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycopro...(truncated) | 1,064 | {} | 2022-02-04 00:53:08 | |
| ¶ | pypath.inputs.matrixdb._matrixdb_protein_list |
Not calling `pypath.inputs.matrixdb._matrixdb_protein_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.matrixdb.matrixdb_annotations | 2022-02-04 00:53:08 | 2022-02-04 00:53:11 | 2.80 | dict | {'H3BR10': {MatrixdbAnnotation(mainclass='membrane')}, 'Q8IVL8': {MatrixdbAnnotation(mainclass='secreted'), MatrixdbAnnotation(mainclass='membrane')}, 'P46095': {MatrixdbAnnotation(mainclass='membrane')}, 'Q8N668': {MatrixdbAnnotation(mainclass='membrane')}, 'Q96E35': {MatrixdbAnnotation(mainclass='...(truncated) | 10,099 | {} | 2022-02-04 00:53:08 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_ecm_proteins | 2022-02-04 00:53:11 | 2022-02-04 00:53:11 | 0.06 | set | {'Q9UKP5', 'Q96I82', 'Q9BUD6', 'Q9BXX0', 'P52803', 'O14936', 'Q86Y22', 'O60938', 'Q17R60', 'Q9UNA0', 'Q6UXI9', 'Q03167', 'Q5VXM1', 'P04004', 'Q9UBB9', 'Q6UX39', 'P55082', 'P39900', 'Q6UXA7', 'P05997', 'Q8TE56', 'Q14055', 'P45452', 'Q12805', 'P48307', 'Q9NS15', 'Q7L985', 'Q8WVF2', 'Q93098', 'Q9UBX5',...(truncated) | 483 | {} | 2022-02-04 00:53:11 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_interactions | 2022-02-04 00:53:11 | 2022-02-04 00:53:12 | 0.16 | list | [['P13497', 'Q15113', '20979576', 'protease assay'], ['O00206', 'P21810', '24480070', 'microscale thermophoresis'], ['P49747', 'O15232', '22521401', 'enzyme linked immunosorbent assay'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O...(truncated) | 425 | {} | 2022-02-04 00:53:11 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_membrane_proteins | 2022-02-04 00:53:12 | 2022-02-04 00:53:13 | 1.85 | set | {'H3BR10', 'Q8IVL8', 'P46095', 'Q8N668', 'Q96E35', 'Q8NGD1', 'Q9UIJ5', 'P83436', 'Q6DN72', 'P52803', 'Q8TCQ1', 'Q9UJM3', 'Q86Y22', 'P78329', 'P10301', 'Q8NEA5', 'Q9Y3A6', 'Q9NZT2', 'Q14168', 'Q8TCB6', 'Q8IYP9', 'Q9NYZ3', 'P56747', 'Q7Z4N2', 'Q7Z7H3', 'Q969S0', 'Q8TEB7', 'Q15049', 'Q96SW2', 'Q99807',...(truncated) | 8,241 | {} | 2022-02-04 00:53:12 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_secreted_proteins | 2022-02-04 00:53:13 | 2022-02-04 00:53:14 | 0.30 | set | {'Q8IVL8', 'Q13519', 'B2RUY7', 'Q9Y2J8', 'Q13046', 'Q5SY68', 'Q9NZH0', 'P54793', 'Q6UXB0', 'Q86Y22', 'Q8TC92', 'Q9BU76', 'Q17R60', 'Q9UNA0', 'Q9NRI6', 'Q9UBD3', 'P54107', 'P35916', 'Q92796', 'A0A0C4DH69', 'P0C869', 'Q6UX39', 'Q86U17', 'P19438', 'Q6MZM9', 'Q5VXJ0', 'P39900', 'P25787', 'P05997', 'P076...(truncated) | 2,925 | {} | 2022-02-04 00:53:13 | |
| ¶ | pypath.inputs.mcam.mcam_cell_adhesion_molecules | 2022-02-04 00:53:14 | 2022-02-04 00:53:15 | 0.89 | set | {'O95471', 'Q08174', 'Q13308', 'Q8WWQ8', 'Q6MZM7', 'O14525', 'Q59H14', 'P34741', 'Q49MI3', 'Q5ZPR3', 'P78325', 'O00548', 'Q14956', 'Q9NZ94', 'Q6MZF4', 'O94856', 'P56856', 'Q9HBB8', 'Q6UWL6', 'Q8TEW0', 'Q13797', 'P56748', 'P08F94', 'P62079', 'Q13895', 'Q9UKX5', 'Q6ZW63', 'O95500', 'P02751', 'Q9BXN2',...(truncated) | 103 | {} | 2022-02-04 00:53:14 | |
| ¶ | pypath.inputs.membranome.membranome_annotations | 2022-02-04 00:53:15 | 2022-02-04 00:53:37 | 22.86 | list | [('P08575', 'Plasma membrane', 'extracellular side'), ('P23468', 'Plasma membrane', 'extracellular side'), ('P10586', 'Plasma membrane', 'extracellular side'), ('P23470', 'Plasma membrane', 'extracellular side'), ('Q13332', 'Plasma membrane', 'extracellular side'), ('P23471', 'Plasma membrane', 'ext...(truncated) | 2,347 | {} | 2022-02-04 00:53:15 | |
| ¶ | pypath.inputs.mimp.get_kinase_class | 2022-02-04 00:53:37 | 2022-02-04 00:53:39 | 1.19 | dict | {'groups': {'AGC': ['AKT1', 'AKT2', 'AKT3', 'DMPK1', 'DMPK2', 'MRCKb', 'MRCKa', 'MRCK', 'ROCK2', 'ROCK1', 'CRIK', 'BARK1', 'BARK2', 'GPRK4', 'GPRK5', 'GPRK6', 'RHOK', 'GPRK6', 'GPRK7', 'MAST3', 'MAST2', 'MAST1', 'MASTL', 'MAST4', 'NDR1', 'LATS1', 'LATS2', 'NDR2', 'PKACa', 'PKACb', 'PKACg', 'PRKX', '...(truncated) | 4 | {} | 2022-02-04 00:53:37 | |
| ¶ | pypath.inputs.mimp.mimp_enzyme_substrate | 2022-02-04 00:53:39 | 2022-02-04 00:53:42 | 3.66 | list | [{'instance': 'VVGARRSSWRVISSI', 'kinase': 'PDKC', 'resaa': 'S', 'resnum': 60, 'npmid': 8, 'substrate_refseq': 'NM_003404', 'substrate': 'YWHAB', 'start': 53, 'end': 67, 'databases': ['HPRD', 'phosphoELM', 'PhosphoSite']}, {'instance': 'VVGARRSSWRVISSI', 'kinase': 'PRKCD', 'resaa': 'S', 'resnum': 60...(truncated) | 17,030 | {} | 2022-02-04 00:53:39 | |
| ¶ | pypath.inputs.mimp.mimp_interactions | 2022-02-04 00:53:42 | 2022-02-04 00:53:43 | 0.55 | list | [['PDKC', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCD', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCZ', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PDKC', 'YWHAH', ['phosphoELM', 'PhosphoSite']], ['ATM', 'EIF4EBP1', ['phosphoELM', 'PhosphoSite']], ['RORC', 'EIF4EBP1', ...(truncated) | 17,030 | {} | 2022-02-04 00:53:42 | |
| ¶ | pypath.inputs.mir2disease.mir2disease_interactions | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.23 | list | [Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='KRAS', year='2008', sentence="A SNP in a let-7 microRNA complementary site in the KRAS 3' untranslated region increases non-small cell lung cancer risk."), Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='HMGA2', year='2008'...(truncated) | 805 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.get_mirbase_aliases | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.08 | tuple | ({'MIMAT0000062': {'hsa-let-7a', 'hsa-let-7a-5p'}, 'MIMAT0000063': {'hsa-let-7b-5p', 'hsa-let-7b'}, 'MIMAT0000064': {'hsa-let-7c-5p', 'hsa-let-7c'}, 'MIMAT0000065': {'hsa-let-7d', 'hsa-let-7d-5p'}, 'MIMAT0000066': {'hsa-let-7e-5p', 'hsa-let-7e'}, 'MIMAT0000067': {'hsa-let-7f', 'hsa-let-7f-5p'}, 'MIM...(truncated) | 2 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_ids | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.09 | list | [('MIMAT0000062', 'MI0000062'), ('MIMAT0000062', 'MI0000060'), ('MIMAT0000062', 'MI0000061'), ('MIMAT0000063', 'MI0000063'), ('MIMAT0000064', 'MI0000064'), ('MIMAT0000065', 'MI0000065'), ('MIMAT0000066', 'MI0000066'), ('MIMAT0000067', 'MI0000068'), ('MIMAT0000067', 'MI0000067'), ('MIMAT0000068', 'MI...(truncated) | 3,027 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_mature | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.06 | list | [('MIMAT0000062', 'hsa-let-7a'), ('MIMAT0000062', 'hsa-let-7a-5p'), ('MIMAT0000063', 'hsa-let-7b-5p'), ('MIMAT0000063', 'hsa-let-7b'), ('MIMAT0000064', 'hsa-let-7c-5p'), ('MIMAT0000064', 'hsa-let-7c'), ('MIMAT0000065', 'hsa-let-7d'), ('MIMAT0000065', 'hsa-let-7d-5p'), ('MIMAT0000066', 'hsa-let-7e-5p...(truncated) | 3,487 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_mature_all | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.09 | list | ['MIMAT0000062', 'MIMAT0000062', 'MIMAT0000062', 'MIMAT0000063', 'MIMAT0000064', 'MIMAT0000065', 'MIMAT0000066', 'MIMAT0000067', 'MIMAT0000067', 'MIMAT0000068', 'MIMAT0000069', 'MIMAT0000069', 'MIMAT0000070', 'MIMAT0000071', 'MIMAT0000072', 'MIMAT0000073', 'MIMAT0000074', 'MIMAT0000074', 'MIMAT00000...(truncated) | 3,027 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor | 2022-02-04 00:53:43 | 2022-02-04 00:53:43 | 0.06 | list | [('MI0000060', 'hsa-let-7a-1'), ('MI0000060', 'hsa-let-7a-1L'), ('MI0000061', 'hsa-let-7a-2L'), ('MI0000061', 'hsa-let-7a-2'), ('MI0000062', 'hsa-let-7a-3'), ('MI0000062', 'hsa-let-7a-3L'), ('MI0000063', 'hsa-let-7bL'), ('MI0000063', 'hsa-let-7b'), ('MI0000064', 'hsa-let-7cL'), ('MI0000064', 'hsa-le...(truncated) | 2,173 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor_all | 2022-02-04 00:53:43 | 2022-02-04 00:53:44 | 0.09 | list | ['MI0000062', 'MI0000060', 'MI0000061', 'MI0000063', 'MI0000064', 'MI0000065', 'MI0000066', 'MI0000068', 'MI0000067', 'MI0000069', 'MI0000115', 'MI0000070', 'MI0000071', 'MI0000071', 'MI0000072', 'MI0000073', 'MI0000075', 'MI0000074', 'MI0000076', 'MI0000077', 'MI0000078', 'MI0000079', 'MI0000080', ...(truncated) | 3,027 | {} | 2022-02-04 00:53:43 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor_to_mature | 2022-02-04 00:53:44 | 2022-02-04 00:53:44 | 0.15 | list | [('hsa-let-7a-1', 'MIMAT0004481'), ('hsa-let-7a-1', 'MIMAT0000062'), ('hsa-let-7a-1L', 'MIMAT0004481'), ('hsa-let-7a-1L', 'MIMAT0000062'), ('hsa-let-7a-2L', 'MIMAT0004481'), ('hsa-let-7a-2L', 'MIMAT0010195'), ('hsa-let-7a-2L', 'MIMAT0000062'), ('hsa-let-7a-2', 'MIMAT0004481'), ('hsa-let-7a-2', 'MIMA...(truncated) | 3,361 | {} | 2022-02-04 00:53:44 | |
| ¶ | pypath.inputs.mirdeathdb.mirdeathdb_interactions | 2022-02-04 00:53:44 | 2022-02-04 00:53:44 | 0.21 | list | [MirdeathdbInteraction(mirna='MIMAT0020823', target_entrez='40009', organism=7227, pubmed='12679032', function='apoptosis_down'), MirdeathdbInteraction(mirna='MIMAT0000365', target_entrez='40009', organism=7227, pubmed='12679032', function='apoptosis_down'), MirdeathdbInteraction(mirna='MIMAT0020823...(truncated) | 462 | {} | 2022-02-04 00:53:44 | |
| ¶ | pypath.inputs.mirecords.mirecords_interactions | 2022-02-04 00:53:44 | 2022-02-04 00:53:49 | 4.65 | list | [MirecordsInteraction(mirna_name='hsa-miR-23a', target_refseq='NM_198155', target_genesymbol='C21orf33', mirna_organism='Homo sapiens', target_organism='Homo sapiens', pmid='12808467'), MirecordsInteraction(mirna_name='mmu-miR-434-3p', target_refseq='NM_184109', target_genesymbol='Rtl1', mirna_organ...(truncated) | 3,106 | {} | 2022-02-04 00:53:44 | |
| ¶ | pypath.inputs.mirtarbase._mirtarbase_interactions |
Not calling `pypath.inputs.mirtarbase._mirtarbase_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mirtarbase.mirtarbase_interactions | 2022-02-04 00:53:49 | 2022-02-04 00:54:03 | 14.10 | list | [MirtarbaseInteraction(mirtarbase_id='MIRT003135', mirna_name='mmu-miR-122-5p', mirna_organism='Mus musculus', target_genesymbol='Cd320', target_entrez='54219', target_organism='Mus musculus', target_site='AGAGACTGGGGTCCTCAGACACTCCC', method='Luciferase reporter assay//qRT-PCR//Western blot', catego...(truncated) | 21,560 | {} | 2022-02-04 00:53:49 | |
| ¶ | pypath.inputs.mitab.mitab_field_list |
Not calling `pypath.inputs.mitab.mitab_field_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mitab.mitab_field_uniprot |
Not calling `pypath.inputs.mitab.mitab_field_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mppi.mppi_interactions | 2022-02-04 00:54:03 | 2022-02-04 00:54:03 | 0.48 | list | [['9867828', '9867828', 'P05109', 'SP', 'S100A8;CAGA;MRP8; calgranulin A (migration inhibitory factor-related protein 8)', '9606', 'P06702', 'SP', 'S100A9;CAGB;MRP14; calgranulin B (migration inhibitory factor-related protein 14)', '9606'], ['9867828', '9867828', 'P06702', 'SP', 'S100A9;CAGB;MRP14; ...(truncated) | 777 | {} | 2022-02-04 00:54:03 | |
| ¶ | pypath.inputs.msigdb.msigdb_annotations | 2022-02-04 00:54:03 | 2022-02-04 00:56:01 | 117.67 | dict | {'Q03518': {MsigdbAnnotation(collection='chemical_and_genetic_perturbations', geneset='CASTELLANO_NRAS_TARGETS_UP'), MsigdbAnnotation(collection='immunologic_signatures', geneset='GSE45365_WT_VS_IFNAR_KO_CD8A_DC_DN'), MsigdbAnnotation(collection='immunologic_signatures', geneset='GSE20715_0H_VS_48H_...(truncated) | 20,047 | {} | 2022-02-04 00:54:03 | |
| ¶ | pypath.inputs.msigdb.msigdb_download | 2022-02-04 00:56:03 | 2022-02-04 00:56:16 | 13.59 | dict | {'chr1p12': {'WARS2-AS1', 'HSD3B2', 'GAPDHP58', 'RBMX2P3', 'GAPDHP33', 'TBX15', 'TENT5C', 'MAN1A2', 'PNRC2P1', 'WARS2-IT1', 'SEC22B', 'HAO2', 'HSD3B1', 'LINC01525', 'NOTCH2P1', 'GDAP2', 'HAO2-IT1', 'SPAG17', 'GAPDHP27', 'ADAM30', 'GAPDHP23', 'HSD3BP2', 'RPS3AP12', 'LINC00622', 'WDR3', 'LINC01780', '...(truncated) | 32,284 | {} | 2022-02-04 00:56:03 | |
| ¶ | pypath.inputs.msigdb.msigdb_download_collections | 2022-02-04 00:56:17 | 2022-02-04 00:56:17 | 0.46 | dict | {('hallmark', 'h.all'): {'HALLMARK_TNFA_SIGNALING_VIA_NFKB': {'CCL2', 'TNC', 'ZBTB10', 'GADD45A', 'PLEK', 'PFKFB3', 'SERPINB2', 'BMP2', 'TUBB2A', 'IL15RA', 'F2RL1', 'MXD1', 'ATP2B1', 'CSF2', 'NFKBIA', 'CXCL10', 'SGK1', 'RELA', 'CDKN1A', 'PTPRE', 'SIK1', 'TNFAIP2', 'INHBA', 'ABCA1', 'KDM6B', 'PANX1',...(truncated) | 13 | {} | 2022-02-04 00:56:17 | |
| ¶ | pypath.inputs.ncrdeathdb.ncrdeathdb_interactions | 2022-02-04 00:56:17 | 2022-02-04 00:56:18 | 0.38 | list | [NcrdeathdbInteraction(ncrna='MIMAT0000062', target_gene='ain-1', ncrna_type='miRNA', pathway='autophagy', effect='down', pmid='23619095', organism=6239), NcrdeathdbInteraction(ncrna='MIMAT0000063', target_gene='ain-1', ncrna_type='miRNA', pathway='autophagy', effect='down', pmid='23619095', organis...(truncated) | 7,305 | {} | 2022-02-04 00:56:17 | |
| ¶ | pypath.inputs.negatome.negatome_interactions | 2022-02-04 00:56:18 | 2022-02-04 00:56:18 | 0.08 | list | [NegatomeInteraction(uniprot_a='Q6ZNK6', uniprot_b='Q9Y4K3', pmid='15047173', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='Q9NR31', uniprot_b='Q15797', pmid='17356069', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='P11627', uniprot_b='P53986', pmid='20155396', me...(truncated) | 2,171 | {} | 2022-02-04 00:56:18 | |
| ¶ | pypath.inputs.netbiol._netbiol_interactions |
Not calling `pypath.inputs.netbiol._netbiol_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.netbiol.arn_interactions | 2022-02-04 00:56:18 | 2022-02-04 00:56:18 | 0.14 | list | [ArnInteraction(source_uniprot='O15350', target_uniprot='O95352', is_direct='0', is_directed='1', effect='0', source_autophagy='0', target_autophagy='1', references='19001857'), ArnInteraction(source_uniprot='O15350', target_uniprot='Q9H1Y0', is_direct='0', is_directed='1', effect='0', source_autoph...(truncated) | 95 | {} | 2022-02-04 00:56:18 | |
| ¶ | pypath.inputs.netbiol.nrf2ome_interactions | 2022-02-04 00:56:18 | 2022-02-04 00:56:18 | 0.14 | list | [Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='O15379', is_direct='1', is_directed='0', effect='0', references='18241676'), Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='Q16236', is_direct='0', is_directed='1', effect='-1', references='18241676'), Nrf2omeInteraction(sourc...(truncated) | 109 | {} | 2022-02-04 00:56:18 | |
| ¶ | pypath.inputs.netpath.netpath_interactions | 2022-02-04 00:56:18 | 2022-02-04 00:56:20 | 2.15 | list | [['IL4R', '3566', 'IL4R', '3566', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL4R', '3566', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL2RG', '3561', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleu...(truncated) | 7,555 | {} | 2022-02-04 00:56:18 | |
| ¶ | pypath.inputs.netpath.netpath_names | 2022-02-04 00:56:20 | 2022-02-04 00:56:20 | 0.01 | dict | {'137': 'Advanced glycation end-products (AGE/RAGE)', '1': 'Alpha6 Beta4 Integrin', '2': 'Androgen receptor (AR)', '12': 'B cell receptor (BCR)', '76': 'Brain-derived neurotrophic factor (BDNF)', '129': 'Corticotropin-releasing hormone (CRH)', '4': 'Epidermal growth factor receptor (EGFR)', '25': 'F...(truncated) | 35 | {} | 2022-02-04 00:56:20 | |
| ¶ | pypath.inputs.netpath.netpath_pathway_annotations | 2022-02-04 00:56:20 | 2022-02-04 00:56:48 | 28.11 | dict | {'Q15109': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'O95831': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P54819': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P31749': {NetpathPathway(pathway='Kit Receptor'), Ne...(truncated) | 1,868 | {} | 2022-02-04 00:56:20 | |
| ¶ | pypath.inputs.ontology.listof_ontologies | 2022-02-04 00:56:48 | 2022-02-04 00:56:49 | 0.93 | dict | {'aeo': 'Anatomical Entity Ontology', 'afo': 'Allotrope Merged Ontology Suite', 'agro': 'Agronomy Ontology', 'aism': 'Ontology for the Anatomy of the Insect SkeletoMuscular system', 'apo': 'Ascomycete Phenotype Ontology (APO)', 'apollo_sv': 'Apollo Structured Vocabulary (Apollo-SV)', 'aro': 'Antibio...(truncated) | 273 | {} | 2022-02-04 00:56:48 | |
| ¶ | pypath.inputs.ontology.ontology |
Not calling `pypath.inputs.ontology.ontology`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.opm.opm_annotations | 2022-02-04 00:56:49 | 2022-02-04 00:57:00 | 10.36 | dict | {'O14745': {OpmAnnotation(membrane='Eykaryo. plasma', family='FXYD regulators', transmembrane=True)}, 'P08842': {OpmAnnotation(membrane='Endoplasm. reticulum', family='Sulfatase', transmembrane=True)}, 'P59666': {OpmAnnotation(membrane='Secreted', family='Vertebrate defensin', transmembrane=False)},...(truncated) | 404 | {'size': 1} | 2022-02-04 00:56:49 | |
| ¶ | pypath.inputs.oreganno.oreganno_interactions | 2022-02-04 00:57:00 | 2022-02-04 00:59:04 | 124.49 | list | [OregannoInteraction(tf='ESR1', target='MACROD1', pmid='15691879'), OregannoInteraction(tf='ESR1', target='MACROD1', pmid='15691879'), OregannoInteraction(tf='ESR1', target='MACROD1', pmid='15691879'), OregannoInteraction(tf='SP1', target='MACROD1', pmid='15691879'), OregannoInteraction(tf='SP1', ta...(truncated) | 5,903 | {} | 2022-02-04 00:57:00 | |
| ¶ | pypath.inputs.oreganno.oreganno_raw | 2022-02-04 00:59:04 | 2022-02-04 00:59:17 | 12.91 | list | [('OREG0000000', 'Homo sapiens', 'POSITIVE OUTCOME', 'REGULATORY POLYMORPHISM', 'CTLA4', '1493', 'NCBI', 'N/A', 'N/A', 'N/A', 'rs3087243', '12724780', 'N/A', 'hg18', '1', 'chr2', '204447164', '204447164'), ('OREG0000000', 'Homo sapiens', 'POSITIVE OUTCOME', 'REGULATORY POLYMORPHISM', 'CTLA4', '1493'...(truncated) | 5,688,970 | {} | 2022-02-04 00:59:04 | |
| ¶ | pypath.inputs.panglaodb.panglaodb_annotations | 2022-02-04 00:59:17 | 2022-02-04 00:59:23 | 5.79 | defaultdict | defaultdict(<class 'set'>, {'P17538': {PanglaodbAnnotation(canonical_marker=True, cell_type='Acinar cells', organ='Pancreas', germ_layer='Endoderm', entity_type='protein', human=(True,), mouse=(True,), human_sensitivity=1.0, mouse_sensitivity=0.957143, human_specificity=0.000628931, mouse_specificit...(truncated) | 4,810 | {} | 2022-02-04 00:59:17 | |
| ¶ | pypath.inputs.panglaodb.panglaodb_raw | 2022-02-04 00:59:23 | 2022-02-04 00:59:23 | 0.04 | list | [{'species': 'Mm Hs', 'official gene symbol': 'CTRB1', 'cell type': 'Acinar cells', 'nicknames': 'CTRB', 'ubiquitousness index': '0.017', 'product description': 'chymotrypsinogen B1', 'gene type': 'protein-coding gene', 'canonical marker': '1', 'germ layer': 'Endoderm', 'organ': 'Pancreas', 'sensiti...(truncated) | 8,286 | {} | 2022-02-04 00:59:23 | |
| ¶ | pypath.inputs.pathwaycommons._create_single_resource_method |
Not calling `pypath.inputs.pathwaycommons._create_single_resource_method`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons.pathwaycommons_interactions | 2022-02-04 00:59:23 | 2022-02-04 00:59:37 | 13.49 | list | [PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='ANXA7', resource='IntAct'), PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='CDKN1A', resource='IntAct'), PathwayCommonsInteraction(id_a='A1BG', interaction_type='interacts-with', id_b='FD...(truncated) | 1,261,865 | {} | 2022-02-04 00:59:23 | |
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pazar.pazar_interactions | 2022-02-04 00:59:37 | 2022-02-04 00:59:38 | 0.27 | list | [PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='9571041'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG...(truncated) | 16,386 | {} | 2022-02-04 00:59:37 | |
| ¶ | pypath.inputs.pdb.pdb_chains | 2022-02-04 00:59:38 | 2022-02-04 00:59:57 | 19.21 | tuple | ({'P02185': [{'pdb': '101m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset': 1}, {'pdb': '102m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset':...(truncated) | 2 | {} | 2022-02-04 00:59:38 | |
| ¶ | pypath.inputs.pdb.pdb_complexes | 2022-02-04 00:59:59 | 2022-02-04 01:00:06 | 7.22 | dict | {'COMPLEX:P00720': Complex: COMPLEX:P00720, 'COMPLEX:P09211': Complex: COMPLEX:P09211, 'COMPLEX:P00817': Complex: COMPLEX:P00817, 'COMPLEX:P00963': Complex: COMPLEX:P00963, 'COMPLEX:P00669': Complex: COMPLEX:P00669, 'COMPLEX:P07378': Complex: COMPLEX:P07378, 'COMPLEX:P01837_P01869': Complex: COMPLEX...(truncated) | 39,217 | {} | 2022-02-04 00:59:59 | |
| ¶ | pypath.inputs.pdb.pdb_uniprot | 2022-02-04 01:00:07 | 2022-02-04 01:00:09 | 2.41 | tuple | ({'P02185': {('5utb', 'X-ray', 1.78), ('2mgl', 'X-ray', 2.0), ('4pnj', 'X-ray', 1.36), ('1vxa', 'X-ray', 2.0), ('1v9q', 'X-ray', 1.45), ('3m3b', 'X-ray', 1.6), ('1f63', 'X-ray', 1.8), ('2zsq', 'X-ray', 1.21), ('5ilr', 'X-ray', 1.87), ('5oja', 'X-ray', 1.35), ('1f65', 'X-ray', 1.7), ('1cio', 'X-ray',...(truncated) | 2 | {} | 2022-02-04 01:00:07 | |
| ¶ | pypath.inputs.pdzbase.pdzbase_interactions | 2022-02-04 01:00:09 | 2022-02-04 01:00:10 | 0.61 | list | [PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P13569', isoform_ligand=1, genesymbol_pdz='NHERF-1', genesymbol_ligand='CFTR', pdz_domain=1, organism=9606, pubmed=9613608), PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P40879', isoform_ligand=1, gen...(truncated) | 339 | {} | 2022-02-04 01:00:09 | |
| ¶ | pypath.inputs.pepcyber.pepcyber_details |
Not calling `pypath.inputs.pepcyber.pepcyber_details`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pepcyber.pepcyber_interactions | 2022-02-04 01:00:10 | 2022-02-04 01:13:12 | 782.40 | list | [PepcyberInteraction(ppdb_class='14-3-3', ppdb_genesymbol='LOC284100', substrate_genesymbol='Bad', binding_seq='SPFRGRSRpSAPPNLWAA', binding_pos=136, all_evidences='Inference', n_records=1, category='A', substrate_residue='S', ppdb_uniprot='A2RUB5', ppdb_refseq='XP_375443', substrate_uniprot='Q61337...(truncated) | 5,590 | {} | 2022-02-04 01:00:10 | |
| ¶ | pypath.inputs.pfam._pfam_uniprot |
Not calling `pypath.inputs.pfam._pfam_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pfam.pfam_names | 2022-02-04 01:13:12 | 2022-02-04 01:13:13 | 0.85 | tuple | ({'PFAM_NAME': {'PFAM_ACCESSION'}, 'Globin': {'PF00042'}, 'Phage_lysozyme': {'PF00959'}, 'GST_N': {'PF02798'}, 'GST_C_3': {'PF14497'}, 'DNA_methylase': {'PF00145'}, 'Pyrophosphatase': {'PF00719'}, 'AsnA': {'PF03590'}, 'RnaseA': {'PF00074'}, 'Ras': {'PF00071'}, 'Carb_anhydrase': {'PF00194'}, 'Lys': {...(truncated) | 2 | {} | 2022-02-04 01:13:12 | |
| ¶ | pypath.inputs.pfam.pfam_pdb | 2022-02-04 01:13:13 | 2022-02-04 01:13:16 | 2.59 | tuple | ({'101m': {'PF00042': PfamDomain(chain='A', start=27, end=143)}, '102l': {'PF00959': PfamDomain(chain='A', start=24, end=149)}, '102m': {'PF00042': PfamDomain(chain='A', start=27, end=143)}, '103l': {'PF00959': PfamDomain(chain='A', start=24, end=151)}, '103m': {'PF00042': PfamDomain(chain='A', star...(truncated) | 2 | {} | 2022-02-04 01:13:13 | |
| ¶ | pypath.inputs.pfam.pfam_regions | 2022-02-04 01:13:16 | 2022-02-04 01:18:46 | 329.57 | tuple | ({}, {}) | 2 | {} | 2022-02-04 01:13:16 | |
| ¶ | pypath.inputs.pfam.pfam_uniprot | 2022-02-04 01:18:46 | 2022-02-04 01:23:24 | 277.99 | tuple | ({'Q8IYP9': {'PF01529'}, 'Q9Y5R8': {'PF04099'}, 'Q9C0F3': {'PF01352', 'PF00096'}, 'Q17R98': {'PF00096'}, 'Q99865': {'PF02513'}, 'P12270': {'PF07926'}, 'A6NLX3': {'PF11357'}, 'P21283': {'PF03223'}, 'A0A1B0GX95': {'PF07686'}, 'Q9NRH3': {'PF03953', 'PF00091'}, 'P40126': {'PF00264'}, 'B2RXF0': set(), 'Q...(truncated) | 2 | {} | 2022-02-04 01:18:46 | |
| ¶ | pypath.inputs.phobius.phobius_annotations | 2022-02-04 01:23:24 | 2022-02-04 01:23:24 | 0.45 | dict | {'P01920': {PhobiusAnnotation(tm_helices=1, signal_peptide=True, cytoplasmic=1, non_cytoplasmic=1)}, 'P18440': {PhobiusAnnotation(tm_helices=0, signal_peptide=False, cytoplasmic=0, non_cytoplasmic=1)}, 'P00740': {PhobiusAnnotation(tm_helices=0, signal_peptide=True, cytoplasmic=0, non_cytoplasmic=1)}...(truncated) | 20,350 | {} | 2022-02-04 01:23:24 | |
| ¶ | pypath.inputs.phosphatome.phosphatome_annotations | 2022-02-04 01:23:24 | 2022-02-04 01:23:32 | 7.68 | dict | {'P09923': {PhosphatomeAnnotation(fold='AP', family='AP', subfamily='AP', has_protein_substrates=True, has_non_protein_substrates=True, has_catalytic_activity=True)}, 'P05186': {PhosphatomeAnnotation(fold='AP', family='AP', subfamily='AP', has_protein_substrates=True, has_non_protein_substrates=True...(truncated) | 264 | {} | 2022-02-04 01:23:24 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_enzyme_substrate | 2022-02-04 01:23:32 | 2022-02-04 01:23:34 | 1.63 | list | [{'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 204, 'start': None, 'end': None, 'substrate': 'O14543', 'kinase': 'P06239', 'references': ['12783885'], 'experiment': 'LTP', 'organism': 'Homo sapiens'}, {'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 221, 'start': None, 'end': None...(truncated) | 2,426 | {} | 2022-02-04 01:23:32 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_interactions | 2022-02-04 01:23:34 | 2022-02-04 01:23:34 | 0.63 | list | [['P06239', 'O14543', '12783885', 'Homo sapiens'], ['P06239', 'O14543', '15173187', 'Homo sapiens'], ['P12931', 'O14746', '12808100', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'], ['P06241', 'O15117', '10570256', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'],...(truncated) | 2,426 | {} | 2022-02-04 01:23:34 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_kinases | 2022-02-04 01:23:34 | 2022-02-04 01:23:34 | 0.11 | dict | {'AAK1': 'Q2M2I8', 'Abl': 'P00519', 'Abl2': 'P42684', 'Abl_drome': 'P00522', 'Ack_drome': 'Q9VZI2', 'AFK': 'P80197', 'Akt1_drome': 'Q8INB9', 'ALK': 'Q9UM73', 'Atg1_drome': 'Q9VU14', 'ATM': 'Q13315', 'ATR': 'Q13535', 'Aurora A': 'O14965', 'Aurora B': 'Q96GD4', 'Axl': 'P30530', 'BCKDK': 'O14874', 'BLK...(truncated) | 247 | {} | 2022-02-04 01:23:34 | |
| ¶ | pypath.inputs.phosphonetworks.phosphonetworks_enzyme_substrate | 2022-02-04 01:23:34 | 2022-02-04 01:23:35 | 0.89 | list | [{'instance': 'SSYGISETTLEEIFL', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1242, 'score': 1.0162, 'substrate': 'ABCA1', 'start': 1235, 'end': 1249}, {'instance': 'SYGISETTLEEIFLK', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1243, 'score': 1.0455, 'substrate': 'ABCA1', 'start': 1236, 'end': 1250...(truncated) | 4,417 | {} | 2022-02-04 01:23:34 | |
| ¶ | pypath.inputs.phosphonetworks.phosphonetworks_interactions | 2022-02-04 01:23:35 | 2022-02-04 01:23:35 | 0.02 | list | [['LIMK2', 'PRKCD'], ['CDK4', 'BCL3'], ['MET', 'CTTN'], ['CSNK2A1', 'ARRB2'], ['SYK', 'FCGR2A'], ['STK40', 'MTA1'], ['CAMKK1', 'PPP1R13L'], ['CDK6', 'HLCS'], ['STK38', 'CDCA5'], ['TRIB2', 'HLCS'], ['PRKACA', 'IRF3'], ['CLK4', 'ZYX'], ['MAPK14', 'RPS6KA4'], ['MAP3K8', 'CHEK1'], ['EPHA3', 'ZAP70'], ['...(truncated) | 1,821 | {} | 2022-02-04 01:23:35 | |
| ¶ | pypath.inputs.phosphopoint.phosphopoint_directions | 2022-02-04 01:23:35 | 2022-02-04 01:23:36 | 0.26 | list | [('AKT1', 'AKT1'), ('AKT1', 'AKT2'), ('AKT1', 'ESR2'), ('AKT1', 'PHLPP'), ('AKT1', 'APPL'), ('AKT1', 'TCL6'), ('AKT1', 'GRB10'), ('AKT1', 'HSP90AA1'), ('AKT1', 'HSP90AB1'), ('AKT1', 'APLP2'), ('AKT1', 'IKBKB'), ('AKT1', 'ILK'), ('AKT1', 'IMPDH2'), ('AKT1', 'IRS1'), ('AKT1', 'KRT10'), ('AKT1', 'MDM4'...(truncated) | 9,269 | {} | 2022-02-04 01:23:35 | |
| ¶ | pypath.inputs.phosphopoint.phosphopoint_interactions | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.01 | list | [PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT1', target_entrez='207', category='Category 2'), PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT2', target_entrez='208', category='Category 2'), PhosphopointInt...(truncated) | 9,269 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite._phosphosite_filter_organism |
Not calling `pypath.inputs.phosphosite._phosphosite_filter_organism`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.phosphosite.phosphosite_directions | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.01 | list | [['P28482', 'Q8N122'], ['Q9NYL2', 'Q9NYL2'], ['P12931', 'P00533'], ['O14757', 'P08631'], ['P45983', 'Q96I25'], ['Q02156', 'O14920'], ['P37173', 'P37173'], ['P31749', 'P49840'], ['Q13153', 'Q96P20'], ['P49840', 'P49840'], ['P45984', 'P46937'], ['P06493', 'Q9GZV5'], ['P11309', 'P52907'], ['O14757', 'Q...(truncated) | 8,971 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_enzyme_substrate | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.37 | list | [{'kinase': 'Q9BQI3', 'kinase_org': 'human', 'substrate': 'P05198', 'substrate_org': 'human', 'residue': 'S52', 'motif': 'MILLsELsRRRIRsI', 'resaa': 'S', 'resnum': 52, 'start': 45, 'end': 59, 'instance': 'MILLSELSRRRIRSI'}, {'kinase': 'Q9BQI3', 'kinase_org': 'human', 'substrate': 'P05198', 'substrat...(truncated) | 13,127 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.00 | tuple | ([['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;14530...(truncated) | 2 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_all | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.00 | list | [['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;145302...(truncated) | 9,041 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_curated | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.00 | list | [['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;145302...(truncated) | 4,309 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_new | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.00 | tuple | ([['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;14530...(truncated) | 2 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_noref | 2022-02-04 01:23:36 | 2022-02-04 01:23:36 | 0.00 | list | [['P51451', 'P31995', 'human', 'human', 'MS', ''], ['O14757', 'O60343', 'human', 'human', 'MS', ''], ['Q96GD4', 'Q09666', 'human', 'human', 'MS', ''], ['O14757', 'Q96QD9', 'human', 'human', 'MS', ''], ['P06493', 'O14715', 'human', 'human', 'MS', ''], ['Q5S007', 'P04637', 'human', 'human', 'AB;WB;MA'...(truncated) | 4,732 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_ptm_orthology | 2022-02-04 01:23:36 | 2022-02-04 01:23:41 | 5.38 | dict | {('P31946', 1, 'T', 2, 9606, 'phosphorylation'): {10090: {('Q9CQV8', 1, 'T', 2, 10090, 'phosphorylation')}}, ('Q9CQV8', 1, 'T', 2, 10090, 'phosphorylation'): {9606: {('P31946', 1, 'T', 2, 9606, 'phosphorylation')}}, ('Q9CQV8', 1, 'S', 6, 10090, 'phosphorylation'): {9606: {('P31946', 1, 'S', 6, 9606,...(truncated) | 198,541 | {} | 2022-02-04 01:23:36 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_ptms | 2022-02-04 01:23:42 | 2022-02-04 01:24:10 | 28.00 | list | [<PTM Residue YWHAB-1:T2:20q13.12>, <PTM Residue YWHAB-1:S6:20q13.12>, <PTM Residue YWHAB-1:Y21:20q13.12>, <PTM Residue YWHAB-1:T32:20q13.12>, <PTM Residue YWHAB-1:S39:20q13.12>, <PTM Residue YWHAB-1:S47:20q13.12>, <PTM Residue YWHAB-1:Y50:20q13.12>, <PTM Residue YWHAB-1:S59:20q13.12>, <PTM Residue ...(truncated) | 239,701 | {} | 2022-02-04 01:23:42 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_regsites | 2022-02-04 01:24:10 | 2022-02-04 01:24:11 | 0.53 | dict | {'P41181': [{'aa': 'K', 'res': '270', 'modt': 'ub', 'organism': 'human', 'pmids': {'21209006'}, 'induces': [], 'disrupts': [], 'isoform': 1, 'function': {'protein degradation', 'phosphorylation', 'intracellular localization'}, 'process': {''}, 'comments': 'stimulates phosphorylation of S261', 'posit...(truncated) | 5,298 | {} | 2022-02-04 01:24:10 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_regsites_one_organism | 2022-02-04 01:24:11 | 2022-02-04 01:25:28 | 77.06 | dict | {'P41181': {('K', 270, 'ubiquitination'): {'induces': set(), 'disrupts': set(), 'pmids': {'21209006', '24876223', '28052875', '21148409'}, 'isoforms': {1}, 'process': {''}, 'function': {'protein stabilization', 'phosphorylation', 'intracellular localization', 'protein degradation', 'ubiquitination'}...(truncated) | 3,537 | {} | 2022-02-04 01:24:11 | |
| ¶ | pypath.inputs.phosphosite.regsites_tab |
Not calling `pypath.inputs.phosphosite.regsites_tab`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pisa.pisa_bonds |
Not calling `pypath.inputs.pisa.pisa_bonds`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pisa.pisa_interfaces |
Not calling `pypath.inputs.pisa.pisa_interfaces`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pro.get_pro | 2022-02-04 01:25:28 | 2022-02-04 01:26:04 | 35.50 | Obo | <OBO file `https://proconsortium.org/download/current/pro_reasoned.obo`> | None | {} | 2022-02-04 01:25:28 | |
| ¶ | pypath.inputs.pro.pro_mapping | 2022-02-04 01:26:04 | 2022-02-04 01:26:04 | 0.39 | list | [('PR:000000005', 'P37173'), ('PR:000000005', 'P38438'), ('PR:000000005', 'Q62312'), ('PR:000000005', 'Q90999'), ('PR:000000007', 'A0A0G2KN81'), ('PR:000000009', 'Q16671'), ('PR:000000009', 'Q62893'), ('PR:000000009', 'Q8K592'), ('PR:000000010', 'O57472'), ('PR:000000010', 'Q24025'), ('PR:000000010'...(truncated) | 316,288 | {} | 2022-02-04 01:26:04 | |
| ¶ | pypath.inputs.progeny.progeny_annotations | 2022-02-04 01:26:04 | 2022-02-04 01:26:18 | 13.37 | dict | {'P35250': {ProgenyAnnotation(pathway='WNT', weight=0.465622632141, p_value=0.704579815833), ProgenyAnnotation(pathway='TNFa', weight=-0.12499324201483122, p_value=0.8334557980340556), ProgenyAnnotation(pathway='VEGF', weight=-0.15684553639501156, p_value=0.8477560090795286), ProgenyAnnotation(pathw...(truncated) | 18,599 | {} | 2022-02-04 01:26:04 | |
| ¶ | pypath.inputs.progeny.progeny_raw | 2022-02-04 01:26:18 | 2022-02-04 01:26:20 | 2.13 | DataFrame | gene pathway weight p.value 0 RFC2 EGFR 1.470647 0.001655 1 ESRRA EGFR 0.178590 0.211838 2 HNRNPK EGFR 0.306699 0.084560 3 CBX6 EGFR -0.675507 0.017641 4 ASRGL1 EGFR -0.252328 0.295430 ... ... ... ...(truncated) | 274,143 | {} | 2022-02-04 01:26:18 | |
| ¶ | pypath.inputs.proteinatlas.get_proteinatlas | 2022-02-04 01:26:20 | 2022-02-04 01:27:18 | 57.71 | dict | {'normal': {'adipose tissue:adipocytes': {'O43657': ('Not detected', 'Approved'), 'O60762': ('Medium', 'Approved'), 'Q8IZE3': ('Low', 'Approved'), 'Q9NSG2': ('Medium', 'Uncertain'), 'P09769': ('Not detected', 'Enhanced'), 'P08603': ('Not detected', 'Supported'), 'Q9BTY2': ('Not detected', 'Approved'...(truncated) | 2 | {} | 2022-02-04 01:26:20 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_annotations | 2022-02-04 01:27:19 | 2022-02-04 01:29:08 | 109.00 | dict | {'O43657': {ProtainatlasAnnotation(organ='renal cancer', tissue='renal cancer', level='Not detected', status=None, n_not_detected=5, n_low=1, n_medium=4, n_high=2, prognostic=False, favourable=True, score=0.003832, pathology=True), ProtainatlasAnnotation(organ='glioma', tissue='glioma', level='Not d...(truncated) | 19,364 | {} | 2022-02-04 01:27:19 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_secretome_annotations | 2022-02-04 01:29:11 | 2022-02-04 01:29:13 | 2.05 | dict | {'P10646': {ProteinatlasSecretomeAnnotation(mainclass='Secreted to blood', secreted=True)}, 'P20701': {ProteinatlasSecretomeAnnotation(mainclass='Intracellular or membrane-bound', secreted=False)}, 'Q9NPA2': {ProteinatlasSecretomeAnnotation(mainclass='Secreted to blood', secreted=True)}, 'Q03405': {...(truncated) | 2,593 | {} | 2022-02-04 01:29:11 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_subcellular_annotations | 2022-02-04 01:29:13 | 2022-02-04 01:29:13 | 0.85 | dict | {'Q8IZE3': {ProteinatlasSubcellularAnnotation(location='Nuclear bodies', status='Uncertain'), ProteinatlasSubcellularAnnotation(location='Microtubules', status='Uncertain')}, 'P23511': {ProteinatlasSubcellularAnnotation(location='Nucleoplasm', status='Supported')}, 'Q9Y4W2': {ProteinatlasSubcellular...(truncated) | 6,819 | {} | 2022-02-04 01:29:13 | |
| ¶ | pypath.inputs.protmapper.get_protmapper | 2022-02-04 01:29:14 | 2022-02-04 01:29:24 | 10.40 | tuple | ([{'ID': '0', 'CTRL_NS': 'UP', 'CTRL_ID': 'Q02156', 'CTRL_GENE_NAME': 'PRKCE', 'CTRL_IS_KINASE': 'True', 'TARGET_UP_ID': 'P15336', 'TARGET_GENE_NAME': 'ATF2', 'TARGET_RES': 'T', 'TARGET_POS': '52', 'SOURCES': 'psp,reach,signor,sparser'}, {'ID': '1', 'CTRL_NS': 'FPLX', 'CTRL_ID': 'PKC', 'CTRL_GENE_NA...(truncated) | 2 | {} | 2022-02-04 01:29:14 | |
| ¶ | pypath.inputs.protmapper.protmapper_enzyme_substrate | 2022-02-04 01:29:24 | 2022-02-04 01:29:25 | 0.65 | list | [{'kinase': 'Q02156', 'resaa': 'T', 'resnum': 52, 'references': {'25545367', '24357804', '25728676', '24727247', '22304920'}, 'substrate': 'P15336', 'databases': {'Sparser', 'SIGNOR', 'REACH', 'PhosphoSite'}}, {'kinase': 'Q02156', 'resaa': 'T', 'resnum': 280, 'references': {'23708658', '24727247'}, ...(truncated) | 22,139 | {} | 2022-02-04 01:29:24 | |
| ¶ | pypath.inputs.protmapper.protmapper_interactions |
Not calling `pypath.inputs.protmapper.protmapper_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubchem.pubchem_mapping |
Not calling `pypath.inputs.pubchem.pubchem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.get_pmid |
Not calling `pypath.inputs.pubmed.get_pmid`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.get_pubmeds |
Not calling `pypath.inputs.pubmed.get_pubmeds`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.only_pmids |
Not calling `pypath.inputs.pubmed.only_pmids`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.open_pubmed |
Not calling `pypath.inputs.pubmed.open_pubmed`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.pmids_dict |
Not calling `pypath.inputs.pubmed.pmids_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.pmids_list |
Not calling `pypath.inputs.pubmed.pmids_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ramilowski2015.ramilowski_interactions | 2022-02-04 01:29:25 | 2022-02-04 01:29:26 | 0.65 | list | [Ramilowski2015Interaction(ligand='A2M', receptor='LRP1', references='', resources='HPMR;HPRD;STRING.binding;STRING.experiment;literature supported'), Ramilowski2015Interaction(ligand='AANAT', receptor='MTNR1A', references='', resources='HPMR;literature supported'), Ramilowski2015Interaction(ligand=...(truncated) | 1,894 | {} | 2022-02-04 01:29:25 | |
| ¶ | pypath.inputs.ramilowski2015.ramilowski_locations | 2022-02-04 01:29:26 | 2022-02-04 01:29:32 | 6.51 | dict | {'P04217': {RamilowskiLocation(location='secreted', source='LocTree3', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='UniProt', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='Consensus', tmh=0, note=None, long_note=None), Ramilo...(truncated) | 18,868 | {} | 2022-02-04 01:29:26 | |
| ¶ | pypath.inputs.rdata._patch_rdata | 2022-02-04 01:29:32 | 2022-02-04 01:29:32 | 0.00 | NoneType | None | None | {} | 2022-02-04 01:29:32 | |
| ¶ | pypath.inputs.rdata._rdata_data_frame_get_rownames |
Not calling `pypath.inputs.rdata._rdata_data_frame_get_rownames`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.rdata._rdata_list_get_names |
Not calling `pypath.inputs.rdata._rdata_list_get_names`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._bp_collect_resources |
Not calling `pypath.inputs.reaction._bp_collect_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._process_controls |
Not calling `pypath.inputs.reaction._process_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_collect_resources |
Not calling `pypath.inputs.reaction._reactome_collect_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_collect_species |
Not calling `pypath.inputs.reaction._reactome_collect_species`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_compartment |
Not calling `pypath.inputs.reaction._reactome_compartment`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_extract_id |
Not calling `pypath.inputs.reaction._reactome_extract_id`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_extract_res |
Not calling `pypath.inputs.reaction._reactome_extract_res`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_id |
Not calling `pypath.inputs.reaction._reactome_id`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_reaction |
Not calling `pypath.inputs.reaction._reactome_reaction`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_reactions | 2022-02-04 01:29:32 | 2022-02-04 01:29:46 | 13.79 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/reaction.py", line 985, in _reactome_reactions
for i in sp.find('bqbiol:haspart').find_all('rdf:li'):
AttributeError: 'NoneType' object has no attribute 'find_all'
|
{} | 2022-01-08 00:48:01 | |||
| ¶ | pypath.inputs.reaction._reactome_reactions_et | 2022-02-04 01:29:46 | 2022-02-04 01:29:48 | 2.09 | tuple | ({}, {}, {}) | 3 | {} | 2022-02-04 01:29:46 | |
| ¶ | pypath.inputs.reaction._reactome_res |
Not calling `pypath.inputs.reaction._reactome_res`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_species |
Not calling `pypath.inputs.reaction._reactome_species`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.acsn_biopax | 2022-02-04 01:29:48 | 2022-02-04 01:29:50 | 1.44 | list | ['<?xml version="1.0" encoding="UTF-8"?>\n', '<rdf:RDF\n', ' xmlns:xsd="http://www.w3.org/2001/XMLSchema#"\n', ' xmlns:owl="http://www.w3.org/2002/07/owl#"\n', ' xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"\n', ' xmlns:bp="http://www.biopax.org/release/biopax-level3.owl#"\n', ' xml:base="...(truncated) | 190,854 | {} | 2022-02-04 01:29:48 | |
| ¶ | pypath.inputs.reaction.acsn_interactions_2 |
Not calling `pypath.inputs.reaction.acsn_interactions_2`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_acsn_effects | 2022-02-04 01:29:50 | 2022-02-04 01:29:50 | 0.08 | list | [['FOXO3', 'PIK3CA', '*'], ['FOXO3', 'PIK3CB', '*'], ['FOXO3', 'PIK3CD', '*'], ['FOXO3', 'PIK3CG', '*'], ['AKT1', 'HOMER3', '*'], ['AKT2', 'HOMER3', '*'], ['AKT3', 'HOMER3', '*'], ['CDH2', 'HOMER3', '*'], ['CDK6', 'CDKN2B', '*'], ['ANAPC2', 'RSPO3', '*'], ['AXIN1', 'RSPO3', '*'], ['AXIN2', 'RSPO3', ...(truncated) | 37,288 | {} | 2022-02-04 01:29:50 | |
| ¶ | pypath.inputs.reaction.get_controls |
Not calling `pypath.inputs.reaction.get_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_interactions |
Not calling `pypath.inputs.reaction.get_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_reactions | 2022-02-04 01:29:50 | 2022-02-04 01:32:11 | 141.14 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 784, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/reaction.py", line 1186, in get_reactions
rea.load_all()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/pyreact.py", line 1303, in load_all
self.load_pid()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/pyreact.py", line 1158, in load_pid
parser.process()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/pyreact.py", line 250, in process
self.open_biopax()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/utils/pyreact.py", line 294, in open_biopax
self.opener = curl.FileOpener(self.biopax, **opener_args)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/share/curl.py", line 584, in __init__
if type(file_param) in common.char_types else file_param.name
AttributeError: 'NoneType' object has no attribute 'name'
|
{} | 2022-01-08 00:48:07 | |||
| ¶ | pypath.inputs.reaction.get_soup |
Not calling `pypath.inputs.reaction.get_soup`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.panther_biopax | 2022-02-04 01:32:11 | 2022-02-04 01:32:11 | 0.19 | dict | {'BioPAX/2-arachidonoylglycerol_biosynthesis.owl': <ExFileObject name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/cache/762ca0e0a7ee6d1f14203c6255cf9b3a-BioPAX.tar.gz'>, 'BioPAX/5-Hydroxytryptamine_biosynthesis.owl': <ExFileObject name='/home/omnipath/testing/pypath-i...(truncated) | 178 | {} | 2022-02-04 01:32:11 | |
| ¶ | pypath.inputs.reaction.panther_interactions |
Not calling `pypath.inputs.reaction.panther_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.pid_biopax | 2022-02-04 01:32:11 | 2022-02-04 01:32:13 | 1.67 | NoneType | None | None | {} | 2022-02-04 01:32:11 | |
| ¶ | pypath.inputs.reaction.pid_interactions |
Not calling `pypath.inputs.reaction.pid_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_complex |
Not calling `pypath.inputs.reaction.process_complex`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_controls |
Not calling `pypath.inputs.reaction.process_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_reactions |
Not calling `pypath.inputs.reaction.process_reactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactions_biopax |
Not calling `pypath.inputs.reaction.reactions_biopax`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactome_biopax | 2022-02-04 01:32:13 | 2022-02-04 01:32:44 | 31.64 | TextIOWrapper | <_io.TextIOWrapper name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/cache/reactome_biopax_Homo_sapiens.owl' mode='r' encoding='UTF-8'> | None | {} | 2022-02-04 01:32:13 | |
| ¶ | pypath.inputs.reaction.reactome_bs | 2022-02-04 01:32:44 | 2022-02-04 01:38:43 | 358.98 | list | [('R-HSA-1059683', <?xml version='1.0' encoding='utf-8' standalone='no'?> <sbml level="3" version="1" xmlns="http://www.sbml.org/sbml/level3/version1/core"> <notes> <annotation> <p xmlns="http://www.w3.org/1999/xhtml">SBML generated from Reactome version 79 on 1/9/22 9:39 PM using JSBML version 1.5....(truncated) | 2,553 | {'size': 7} | 2022-02-04 01:32:44 | |
| ¶ | pypath.inputs.reaction.reactome_interactions |
Not calling `pypath.inputs.reaction.reactome_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactome_sbml | 2022-02-04 01:39:01 | 2022-02-04 01:39:03 | 2.05 | dict | {'R-HSA-1059683.sbml': <ExFileObject name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/cache/9cfb9d56283cf7ad3077ba1f8a187542-homo_sapiens.3.1.sbml.tgz'>, 'R-HSA-109581.sbml': <ExFileObject name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-00130...(truncated) | 2,553 | {'size': 7} | 2022-02-04 01:39:01 | |
| ¶ | pypath.inputs.scconnect.scconnect_annotations | 2022-02-04 01:39:03 | 2022-02-04 01:39:15 | 11.54 | dict | {'P41273': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human')}, 'P20292': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human')}, 'P01189': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human'), ScconnectAnnota...(truncated) | 3,285 | {} | 2022-02-04 01:39:03 | |
| ¶ | pypath.inputs.scconnect.scconnect_complexes | 2022-02-04 01:39:15 | 2022-02-04 01:39:15 | 0.15 | set | {Complex: COMPLEX:P01215_P0DN86, Complex: COMPLEX:P01562, Complex: COMPLEX:O15263, Complex: COMPLEX:P29460_Q9NPF7, Complex: COMPLEX:P05496_P48201_Q06055, Complex: COMPLEX:P01374_Q06643, Complex: COMPLEX:P01215_P01225, Complex: COMPLEX:Q14213_Q8NEV9, Complex: COMPLEX:O75462_Q9UBD9, Complex: COMPLEX:P...(truncated) | 17 | {} | 2022-02-04 01:39:15 | |
| ¶ | pypath.inputs.scconnect.scconnect_interactions | 2022-02-04 01:39:15 | 2022-02-04 01:50:33 | 678.09 | list | [ScconnectInteraction(ligand_id='ML355', target_id='P18054', ligand_organism=None, target_organism=9606, ligand_type='small_molecule', target_type='protein', effect='Inhibition', references='24393039'), ScconnectInteraction(ligand_id='PKUMDL_MH_1001', target_id='P16050', ligand_organism=None, target...(truncated) | 20,434 | {} | 2022-02-04 01:39:15 | |
| ¶ | pypath.inputs.science.science_download |
Not calling `pypath.inputs.science.science_download`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.signalink.signalink_annotations | 2022-02-04 01:50:33 | 2022-02-04 01:50:34 | 1.38 | dict | {'pathway': {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Toll-like receptor'), SignalinkPathway(pathway='Innate immune pathways'), Signalin...(truncated) | 2 | {} | 2022-02-04 01:50:33 | |
| ¶ | pypath.inputs.signalink.signalink_function_annotations | 2022-02-04 01:50:34 | 2022-02-04 01:50:35 | 0.79 | dict | {'P43403': {SignalinkFunction(function='Mediator'), SignalinkFunction(function='Scaffold')}, 'Q9NYJ8': {SignalinkFunction(function='Co-factor'), SignalinkFunction(function='Scaffold')}, 'O43318': {SignalinkFunction(function='Mediator')}, 'P15018': {SignalinkFunction(function='Ligand')}, 'P42702': {S...(truncated) | 784 | {} | 2022-02-04 01:50:34 | |
| ¶ | pypath.inputs.signalink.signalink_interactions | 2022-02-04 01:50:35 | 2022-02-04 01:50:36 | 0.42 | list | [SignalinkInteraction(id_a='P20963', id_b='P43403', is_direct=True, is_directed=True, effect=0, pathways_a=['T-cell receptor'], pathways_b=['Receptor tyrosine kinase', 'T-cell receptor'], functions_a=[], functions_b=['Mediator', 'Scaffold'], references=['10358158', '10358164', '10562324', '10925299'...(truncated) | 1,939 | {} | 2022-02-04 01:50:35 | |
| ¶ | pypath.inputs.signalink.signalink_pathway_annotations | 2022-02-04 01:50:36 | 2022-02-04 01:50:36 | 0.55 | dict | {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Toll-like receptor'), SignalinkPathway(pathway='Innate immune pathways'), SignalinkPathway(pat...(truncated) | 836 | {} | 2022-02-04 01:50:36 | |
| ¶ | pypath.inputs.signor.signor_complexes | 2022-02-04 01:50:36 | 2022-02-04 01:50:37 | 0.56 | dict | {'COMPLEX:P23511_P25208_Q13952': Complex NFY: COMPLEX:P23511_P25208_Q13952, 'COMPLEX:P42345_P68104_P85299_Q6R327_Q8TB45_Q9BVC4': Complex mTORC2: COMPLEX:P42345_P68104_P85299_Q6R327_Q8TB45_Q9BVC4, 'COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4': Complex mTORC1: COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4...(truncated) | 3,199 | {} | 2022-02-04 01:50:36 | |
| ¶ | pypath.inputs.signor.signor_enzyme_substrate | 2022-02-04 01:50:37 | 2022-02-04 01:50:39 | 2.49 | list | [{'typ': 'phosphorylation', 'resnum': 189, 'instance': 'YRPKPSSSPVIFAGG', 'substrate': 'Q15366', 'start': 182, 'end': 196, 'kinase': 'P27361', 'resaa': 'S', 'motif': 'YRPKPSSSPVIFAGG', 'enzyme_isoform': None, 'substrate_isoform': None, 'references': {'17475908'}}, {'typ': 'phosphorylation', 'resnum'...(truncated) | 9,970 | {} | 2022-02-04 01:50:37 | |
| ¶ | pypath.inputs.signor.signor_interactions | 2022-02-04 01:50:39 | 2022-02-04 01:50:40 | 0.44 | list | [SignorInteraction(source='P27361', target='Q15366', source_isoform=None, target_isoform=None, source_type='protein', target_type='protein', effect='up-regulates quantity by stabilization', mechanism='phosphorylation', ncbi_tax_id='9606', pubmeds='17475908', direct=True, ptm_type='phosphorylation', ...(truncated) | 35,944 | {'size': 23} | 2022-02-04 01:50:39 | |
| ¶ | pypath.inputs.signor.signor_pathway_annotations | 2022-02-04 01:50:40 | 2022-02-04 01:51:04 | 24.03 | dict | {'Q8N3U4': {SignorPathway(pathway='Acute Myeloid Leukemia')}, 'P15056': {SignorPathway(pathway='PI3K/AKT Signaling'), SignorPathway(pathway='Rhabdomyosarcoma'), SignorPathway(pathway='T cell activation'), SignorPathway(pathway='Acute Myeloid Leukemia'), SignorPathway(pathway='Inhibition of Apoptosis...(truncated) | 607 | {'size': 3} | 2022-02-04 01:50:40 | |
| ¶ | pypath.inputs.signor.signor_pathways |
Not calling `pypath.inputs.signor.signor_pathways`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.signor.signor_protein_families | 2022-02-04 01:51:04 | 2022-02-04 01:51:04 | 0.00 | dict | {'SIGNOR-PF1': ['P28482', 'P27361'], 'SIGNOR-PF2': ['Q9HBW0', 'Q9UBY5', 'Q92633'], 'SIGNOR-PF3': ['O14610', 'O60262', 'Q9P2W3', 'P63215', 'P63211', 'P50150', 'P59768', 'P63218', 'P61952', 'Q9UK08', 'Q9UBI6', 'P50151'], 'SIGNOR-PF4': ['P28482', 'P27361'], 'SIGNOR-PF5': ['P01137', 'P10600', 'P61812'],...(truncated) | 90 | {} | 2022-02-04 01:51:04 | |
| ¶ | pypath.inputs.spike.spike_interactions | 2022-02-04 01:51:04 | 2022-02-04 01:51:07 | 3.53 | list | [['836', 'CASP3', '8669', 'EIF3J', '1', '10672017', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['836', 'CASP3', '3691', 'ITGB4', '1', '17178732', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['407042', 'MIR34C', '4609', 'MYC', '1', '20212154', '1', '2', ...(truncated) | 3,842 | {} | 2022-02-04 01:51:04 | |
| ¶ | pypath.inputs.stitch.stitch_interactions | 2022-02-04 01:51:07 | 2022-02-04 01:52:25 | 77.80 | list | [StitchInteraction(partner_a='00010461', partner_b='ENSP00000170630', mechanism='expression', action='', score=150), StitchInteraction(partner_a='00010461', partner_b='ENSP00000170630', mechanism='expression', action='', score=150), StitchInteraction(partner_a='23627457', partner_b='ENSP00000353915'...(truncated) | 21,773,491 | {} | 2022-02-04 01:51:07 | |
| ¶ | pypath.inputs.string.string_effects | 2022-02-04 01:52:25 | 2022-02-04 01:52:33 | 8.04 | list | [StringInteraction(source='ENSP00000216366', target='ENSP00000000233', effect='*'), StringInteraction(source='ENSP00000000233', target='ENSP00000216366', effect='*'), StringInteraction(source='ENSP00000222547', target='ENSP00000000233', effect='*'), StringInteraction(source='ENSP00000000233', target...(truncated) | 2,250,122 | {} | 2022-02-04 01:52:25 | |
| ¶ | pypath.inputs.surfaceome.surfaceome_annotations | 2022-02-04 01:52:35 | 2022-02-04 01:52:38 | 3.62 | dict | {'A0AV02': (0.8363, 'Transporters', {'SLC', 'SLC12', 'APC'}), 'A0FGR9': (0.0465, 'Unclassified', {'Unclassified'}), 'A0PJK1': (0.8802, 'Transporters', {'SLC5', 'SLC', 'APC'}), 'A0PK11': (0.6108, 'Unclassified', {'Unclassified'}), 'A0ZSE6': (0.6327, 'Miscellaneous', {'Unknown_function', 'TMEM30'}), '...(truncated) | 2,809 | {} | 2022-02-04 01:52:35 | |
| ¶ | pypath.inputs.switches_elm.get_switches_elm | 2022-02-04 01:52:38 | 2022-02-04 01:53:45 | 66.79 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 764, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/switches_elm.py", line 95, in get_switches_elm
mod_ont = ontology.ontology('MOD')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/ontology.py", line 46, in ontology
result = ebi.ebi_rest(url = url, fields = _fields)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220204-001302/pypath/inputs/ebi.py", line 73, in ebi_rest
this_result = json.loads(c.result)
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{'broke': True} | 2022-02-03 01:55:05 | |||
| ¶ | pypath.inputs.talklr.talklr_annotations | 2022-02-04 01:53:45 | 2022-02-04 01:53:46 | 0.96 | dict | {'P01023': {TalklrAnnotation(role='ligand', pmid=None, putative=False)}, 'Q07954': {TalklrAnnotation(role='receptor', pmid='11560994', putative=False), TalklrAnnotation(role='receptor', pmid='21054788', putative=False), TalklrAnnotation(role='receptor', pmid=None, putative=False)}, 'Q16613': {Talklr...(truncated) | 1,346 | {} | 2022-02-04 01:53:45 | |
| ¶ | pypath.inputs.talklr.talklr_interactions | 2022-02-04 01:53:46 | 2022-02-04 01:53:46 | 0.04 | list | [TalklrInteraction(ligand='A2M', receptor='LRP1', pmids=(), resources=('HPRD', 'STRING', 'HPMR'), putative=False), TalklrInteraction(ligand='AANAT', receptor='MTNR1A', pmids=(), resources=('HPMR',), putative=False), TalklrInteraction(ligand='AANAT', receptor='MTNR1B', pmids=(), resources=('HPMR',), ...(truncated) | 2,422 | {} | 2022-02-04 01:53:46 | |
| ¶ | pypath.inputs.talklr.talklr_raw | 2022-02-04 01:53:46 | 2022-02-04 01:53:46 | 0.03 | DataFrame | Pair_Name Ligand_ApprovedSymbol ... Pair_Source Pair_Evidence 0 A2M_LRP1 A2M ... known literature supported 1 AANAT_MTNR1A AANAT ... known literature supported 2 AANAT_MTNR1B AANAT ... known l...(truncated) | 2,422 | {} | 2022-02-04 01:53:46 | |
| ¶ | pypath.inputs.tcdb.tcdb_annotations | 2022-02-04 01:53:46 | 2022-02-04 01:53:51 | 5.26 | dict | {'P60201': {TcdbAnnotation(family='Myelin Proteolipid Protein (MPLP)', tcid='9.B.38.1.2')}, 'Q9NWF4': {TcdbAnnotation(family='Eukaryotic Riboflavin Transporter (E-RFT)', tcid='2.A.125.1.1')}, 'O00161': {TcdbAnnotation(family='Synaptosomal Vesicle Fusion Pore (SVF-Pore)', tcid='1.F.1.1.1')}, 'O00299'...(truncated) | 2,039 | {} | 2022-02-04 01:53:46 | |
| ¶ | pypath.inputs.tcdb.tcdb_classes | 2022-02-04 01:53:51 | 2022-02-04 01:53:51 | 0.03 | dict | {'A0CIB0': ('1.A.17.1.13', '1.A.17'), 'A0CS82': ('9.B.82.1.5', '9.B.82'), 'A0CX44': ('1.A.3.2.4', '1.A.3'), 'A0D5K0': ('2.A.66.3.4', '2.A.66'), 'A0E9B5': ('9.B.38.2.1', '9.B.38'), 'A0ECD9': ('3.A.1.207.1', '3.A.1'), 'A0FKN5': ('2.A.53.2.9', '2.A.53'), 'A0JCJ5': ('1.B.1.1.7', '1.B.1'), 'A0JSP2': ('3....(truncated) | 21,789 | {} | 2022-02-04 01:53:51 | |
| ¶ | pypath.inputs.tcdb.tcdb_families | 2022-02-04 01:53:51 | 2022-02-04 01:53:51 | 0.01 | dict | {'1.A.1': 'Voltage-gated Ion Channel (VIC)', '1.A.10': 'Glutamate-gated Ion Channel (GIC) of Neurotransmitter Receptors', '1.A.100': 'Rhabdoviridae Putative Viroporin, U5 (RV-U5)', '1.A.101': 'Peroxisomal Pore-forming Pex11 (Pex11)', '1.A.102': 'Influenza A viroporin PB1-F2 (PB1-F2)', '1.A.103': 'Si...(truncated) | 1,654 | {} | 2022-02-04 01:53:51 | |
| ¶ | pypath.inputs.tfcensus.tfcensus_annotations | 2022-02-04 01:53:51 | 2022-02-04 01:53:52 | 0.36 | dict | {'P23511': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'Q96QS3': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P31270': {TfcensusAnnotation(tfcensus_class='a', tissue='uterus')}, 'P57073': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P17010': {TfcensusAnnotation(tfcen...(truncated) | 1,886 | {} | 2022-02-04 01:53:51 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_chains | 2022-02-04 01:53:52 | 2022-02-04 01:53:59 | 6.93 | dict | {'code': {'ch_new': 'ch_old'}, '4b5m_1': {'L': 'L', 'A': 'A', 'V': 'V', 'U': 'U'}, '4b5m_2': {'W': 'W', 'M': 'M', 'B': 'B', 'X': 'X'}, '4b5m_3': {'N': 'N', 'Z': 'Z', 'C': 'C', 'Y': 'Y'}, '4abk_1': {'A': 'A'}, '1lsz_1': {'A': 'A'}, '3gll_1': {'C': 'A', 'A': 'A', 'B': 'A'}, '1hz6_4': {'C': 'C', 'A': '...(truncated) | 174,325 | {} | 2022-02-04 01:53:52 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_contacts | 2022-02-04 01:53:59 | 2022-02-04 01:54:38 | 39.42 | set | {ThreedcomplexContact(pdb='5x2y_1', uniprot_1='P13254', uniprot_2='P13254', chain_1='A', chain_2='C', n_residues=30.5, length_1=391, length_2=381, domain_s1=('',), domain_p1=('PF01053.15',), domain_s2=('',), domain_p2=('PF01053.15',), ident=True, homo=True), ThreedcomplexContact(pdb='5udg_1', unipro...(truncated) | 260,008 | {} | 2022-02-04 01:53:59 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_ddi | 2022-02-04 01:54:39 | 2022-02-04 01:57:57 | 197.81 | list | [<pypath.internals.intera.DomainDomain object at 0x7f45dd0d67c0>, <pypath.internals.intera.DomainDomain object at 0x7f45e476a370>, <pypath.internals.intera.DomainDomain object at 0x7f45e98208b0>, <pypath.internals.intera.DomainDomain object at 0x7f45a8de18e0>, <pypath.internals.intera.DomainDomain o...(truncated) | 525,062 | {} | 2022-02-04 01:54:39 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_nresidues | 2022-02-04 01:57:58 | 2022-02-04 01:58:06 | 8.35 | dict | {'5x2y_1': {('P13254', 'P13254'): 30.5}, '5udg_1': {('O31678', 'O31678'): 26.5}, '2dbb_2': {('O57802', 'O57802'): 62.0}, '5l5t_1': {('P23638', 'P25043'): 5.5, ('P32379', 'P40303'): 27.0, ('P32379', 'P40302'): 21.0, ('P22141', 'P30656'): 16.5, ('P21242', 'P40302'): 27.5, ('P23639', 'P40302'): 1.0, ('...(truncated) | 81,288 | {} | 2022-02-04 01:57:58 | |
| ¶ | pypath.inputs.threedid.get_3did | 2022-02-04 01:58:06 | 2022-02-04 02:29:11 | 1,864.36 | tuple | ([<pypath.internals.intera.DomainDomain object at 0x7f45b77c1be0>, <pypath.internals.intera.DomainDomain object at 0x7f45b77c1ac0>, <pypath.internals.intera.DomainDomain object at 0x7f45b77c1520>, <pypath.internals.intera.DomainDomain object at 0x7f45b77c18b0>, <pypath.internals.intera.DomainDomain ...(truncated) | 2 | {} | 2022-02-04 01:58:06 | |
| ¶ | pypath.inputs.threedid.get_3did_ddi | 2022-02-04 02:29:11 | 2022-02-04 02:29:41 | 30.52 | dict | {('Q06830', 'Q9BYN0'): {('PF10417', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0'], '3hy2': ['Q06830', 'Q9BYN0']}}, ('PF00578', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0'], '3hy2': ['Q06830', 'Q9BYN0']}}}, ('Q13162', 'Q9BYN0'): {('PF10417', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0...(truncated) | 3,272,215 | {} | 2022-02-04 02:29:11 | |
| ¶ | pypath.inputs.topdb.topdb_annotations | 2022-02-04 02:30:43 | 2022-02-04 02:30:48 | 4.45 | dict | {'P05067': {TopdbAnnotation(membrane='Extracellular', topology='Inside', score=89, tmregions=1), TopdbAnnotation(membrane='Extracellular', topology='Membrane', score=89, tmregions=1), TopdbAnnotation(membrane='Extracellular', topology='Outside', score=89, tmregions=1), TopdbAnnotation(membrane='Plas...(truncated) | 1,246 | {'size': -1} | 2022-02-04 02:30:43 | |
| ¶ | pypath.inputs.transmir.transmir_interactions | 2022-02-04 02:30:48 | 2022-02-04 02:30:49 | 0.77 | list | [TransmirInteraction(tf_genesymbol='AGO2', mirna='hsa-mir-155', effect='Repression', pubmed='24263100'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-106b', effect='Activation', pubmed='24798859'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-132', effect='Activation', pubmed='...(truncated) | 2,678 | {} | 2022-02-04 02:30:48 | |
| ¶ | pypath.inputs.trip.take_a_trip | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.01 | dict | {'sc': {('P48995', 'Q12791'): [['TRPC1', '', 'BKca', 'Inference', '', '', '', '', '', 'Prediction', '19168436']], ('P48995', 'Q13873'): [['TRPC1', '', 'BMPR-2', 'Affinity purification-mass spectrometry', 'Not used as a bait', '', 'Mouse', 'Leg muscle', 'C2C12 lysates', '', '15188402']], ('P48995', '...(truncated) | 5 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.trip.trip_find_uniprot |
Not calling `pypath.inputs.trip.trip_find_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.trip.trip_get_uniprot |
Not calling `pypath.inputs.trip.trip_get_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.trip.trip_interactions | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.01 | list | [['P48995', 'Q12791', '19168436;25139746', 'Co-immunofluorescence staining;Co-immunoprecipitation', 'unknown'], ['P48995', 'Q08209', '23228564', 'Co-immunoprecipitation', 'unknown'], ['P48995', 'P62158', '12601176;11983166;11290752', 'Calcium measurement;Patch clamp;Fluorescence probe labeling;Fusio...(truncated) | 359 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.trip.trip_process | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.00 | dict | {('P48995', 'Q12791'): {'refs': {'19168436', '25139746'}, 'methods': {'Co-immunofluorescence staining', 'Co-immunoprecipitation'}, 'tissues': {'Rat vascular smooth muscle cell', 'Porcine coronary artery', 'Rat aortic vascular smooth muscle cell', 'HEK293'}, 'effect': set(), 'regions': set()}, ('P489...(truncated) | 359 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.trip.trip_process_table |
Not calling `pypath.inputs.trip.trip_process_table`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem._unichem_mapping |
Not calling `pypath.inputs.unichem._unichem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.info |
Not calling `pypath.inputs.unichem.info`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.unichem_info | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.02 | list | [UnichemSource(number='1', label='chembl', name='ChEMBL', description='A database of bioactive drug-like small molecules and bioactivities abstracted from the scientific literature.', acquisition='Standard InChIs and Keys provided on ftp site for each release.'), UnichemSource(number='2', label='dru...(truncated) | 41 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.unichem.unichem_mapping |
Not calling `pypath.inputs.unichem.unichem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.unichem_sources | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.02 | dict | {'1': 'chembl', '2': 'drugbank', '3': 'pdb', '4': 'gtopdb', '5': 'pubchem_dotf', '6': 'kegg_ligand', '7': 'chebi', '8': 'nih_ncc', '9': 'zinc', '10': 'emolecules', '11': 'ibm', '12': 'atlas', '14': 'fdasrs', '15': 'surechembl', '17': 'pharmgkb', '18': 'hmdb', '20': 'selleck', '21': 'pubchem_tpharma'...(truncated) | 41 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.uniprot._all_uniprots | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.05 | set | {'Q8NEY1', 'A0A0A0MRW7', 'B4DEF2', 'A0A096Y961', 'Q86TZ0', 'T1WF30', 'Q59FS9', 'A0A5C2GKJ0', 'B4E0N7', 'F8VUZ2', 'D3Y5Z2', 'B7Z394', 'A0A3S6RG64', 'V5L5K8', 'A0A0S2Z543', 'O15111', 'A0A2R8Y4Y0', 'A0A493QP97', 'A0A024R7N2', 'A0A0A0MS47', 'X2KYU6', 'A2IBK3', 'F8WDR3', 'L8B934', 'A8K9U7', 'C9JZ94', 'A0...(truncated) | 203,711 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.uniprot._cleanup | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.00 | NoneType | None | None | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.uniprot._protein_datasheet |
Not calling `pypath.inputs.uniprot._protein_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot._remove |
Not calling `pypath.inputs.uniprot._remove`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot._swissprot_param |
Not calling `pypath.inputs.uniprot._swissprot_param`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.all_swissprots | 2022-02-04 02:30:49 | 2022-02-04 02:30:49 | 0.00 | set | {'Q8NEY1', 'Q14119', 'Q9NTX5', 'A0A286YEX9', 'Q7Z4K8', 'O15111', 'Q8NGD1', 'Q99811', 'Q8IYE1', 'Q8ND24', 'Q6UWS5', 'A0PJX2', 'Q8IYM2', 'P78329', 'Q6PL18', 'Q9Y3A6', 'Q86U17', 'Q5VXJ0', 'Q6XD76', 'A4D1F6', 'P39900', 'Q8IYP9', 'P56747', 'P05997', 'Q969S0', 'Q8TEB7', 'Q96SW2', 'Q9H9L7', 'Q99807', 'Q96K...(truncated) | 20,375 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.uniprot.all_trembls | 2022-02-04 02:30:49 | 2022-02-04 02:31:43 | 54.55 | set | {'A0A0A0MRW7', 'Q86TZ0', 'B4DEF2', 'A0A096Y961', 'T1WF30', 'Q59FS9', 'A0A5C2GKJ0', 'B4E0N7', 'D3Y5Z2', 'F8VUZ2', 'B7Z394', 'A0A3S6RG64', 'V5L5K8', 'A0A0S2Z543', 'A0A2R8Y4Y0', 'A0A493QP97', 'A0A024R7N2', 'A0A0A0MS47', 'X2KYU6', 'A2IBK3', 'F8WDR3', 'L8B934', 'A8K9U7', 'C9JZ94', 'A0A286MCF9', 'B4E1B4',...(truncated) | 183,336 | {} | 2022-02-04 02:30:49 | |
| ¶ | pypath.inputs.uniprot.all_uniprots | 2022-02-04 02:31:43 | 2022-02-04 02:31:43 | 0.00 | set | {'Q8NEY1', 'A0A0A0MRW7', 'B4DEF2', 'A0A096Y961', 'Q86TZ0', 'T1WF30', 'Q59FS9', 'A0A5C2GKJ0', 'B4E0N7', 'F8VUZ2', 'D3Y5Z2', 'B7Z394', 'A0A3S6RG64', 'V5L5K8', 'A0A0S2Z543', 'O15111', 'A0A2R8Y4Y0', 'A0A493QP97', 'A0A024R7N2', 'A0A0A0MS47', 'X2KYU6', 'A2IBK3', 'F8WDR3', 'L8B934', 'A8K9U7', 'C9JZ94', 'A0...(truncated) | 203,711 | {} | 2022-02-04 02:31:43 | |
| ¶ | pypath.inputs.uniprot.deleted_uniprot_genesymbol |
Not calling `pypath.inputs.uniprot.deleted_uniprot_genesymbol`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.get_db | 2022-02-04 02:31:43 | 2022-02-04 02:31:43 | 0.00 | set | {'Q8NEY1', 'A0A0A0MRW7', 'B4DEF2', 'A0A096Y961', 'Q86TZ0', 'T1WF30', 'Q59FS9', 'A0A5C2GKJ0', 'B4E0N7', 'F8VUZ2', 'D3Y5Z2', 'B7Z394', 'A0A3S6RG64', 'V5L5K8', 'A0A0S2Z543', 'O15111', 'A0A2R8Y4Y0', 'A0A493QP97', 'A0A024R7N2', 'A0A0A0MS47', 'X2KYU6', 'A2IBK3', 'F8WDR3', 'L8B934', 'A8K9U7', 'C9JZ94', 'A0...(truncated) | 203,711 | {} | 2022-02-04 02:31:43 | |
| ¶ | pypath.inputs.uniprot.get_uniprot_sec | 2022-02-04 02:31:43 | 2022-02-04 02:31:44 | 0.69 | list | [['A0A023IN41', 'H0Y5F6'], ['A0A024QZ37', 'X5D2H9'], ['A0A024QZ45', 'Q9BX63'], ['A0A024QZA1', 'Q5TDG9'], ['A0A024QZG0', 'O75150'], ['A0A024QZR6', 'Q9UII6'], ['A0A024R056', 'A0A140VJJ8'], ['A0A024R072', 'Q96S94'], ['A0A024R077', 'Q96S94'], ['A0A024R079', 'G3V1E2'], ['A0A024R081', 'J3QRY6'], ['A0A024R...(truncated) | 71,862 | {} | 2022-02-04 02:31:43 | |
| ¶ | pypath.inputs.uniprot.init_db | 2022-02-04 02:31:44 | 2022-02-04 02:31:44 | 0.05 | NoneType | None | None | {} | 2022-02-04 02:31:44 | |
| ¶ | pypath.inputs.uniprot.is_swissprot |
Not calling `pypath.inputs.uniprot.is_swissprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.is_trembl |
Not calling `pypath.inputs.uniprot.is_trembl`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.is_uniprot |
Not calling `pypath.inputs.uniprot.is_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.protein_datasheet |
Not calling `pypath.inputs.uniprot.protein_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_data |
Not calling `pypath.inputs.uniprot.uniprot_data`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_families | 2022-02-04 02:31:44 | 2022-02-04 02:31:50 | 5.55 | dict | {'Q96NG5': {UniprotFamily(family='Krueppel C2H2-type zinc-finger protein', subfamily=None)}, 'Q6ZN19': {UniprotFamily(family='Krueppel C2H2-type zinc-finger protein', subfamily=None)}, 'Q86XN6': {UniprotFamily(family='Krueppel C2H2-type zinc-finger protein', subfamily=None)}, 'A8MUZ8': {UniprotFamil...(truncated) | 14,348 | {} | 2022-02-04 02:31:44 | |
| ¶ | pypath.inputs.uniprot.uniprot_history |
Not calling `pypath.inputs.uniprot.uniprot_history`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_history_recent_datasheet |
Not calling `pypath.inputs.uniprot.uniprot_history_recent_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_keywords | 2022-02-04 02:31:50 | 2022-02-04 02:31:58 | 8.09 | dict | {'Q96NG5': {UniprotKeyword(keyword='Reference proteome'), UniprotKeyword(keyword='Zinc'), UniprotKeyword(keyword='Zinc-finger'), UniprotKeyword(keyword='Nucleus'), UniprotKeyword(keyword='Transcription'), UniprotKeyword(keyword='DNA-binding'), UniprotKeyword(keyword='Metal-binding'), UniprotKeyword(...(truncated) | 20,375 | {} | 2022-02-04 02:31:50 | |
| ¶ | pypath.inputs.uniprot.uniprot_locations | 2022-02-04 02:31:58 | 2022-02-04 02:32:07 | 8.83 | dict | {'Q96NG5': {UniprotLocation(location='Nucleus', features=None)}, 'Q6ZN19': {UniprotLocation(location='Nucleus', features=None)}, 'Q86XN6': {UniprotLocation(location='Nucleus', features=None)}, 'A8MUZ8': {UniprotLocation(location='Nucleus', features=None)}, 'Q08ER8': {UniprotLocation(location='Nucleu...(truncated) | 16,812 | {} | 2022-02-04 02:31:58 | |
| ¶ | pypath.inputs.uniprot.uniprot_ncbi_taxids_2 | 2022-02-04 02:32:07 | 2022-02-04 02:32:07 | 0.08 | dict | {648330: Taxon(ncbi_id=648330, latin='Aedes albopictus densovirus (isolate Boublik/1994)', english='AalDNV', latin_synonym=None), 10804: Taxon(ncbi_id=10804, latin='Adeno-associated virus 2', english='AAV-2', latin_synonym=None), 648242: Taxon(ncbi_id=648242, latin='Adeno-associated virus 2 (isolate...(truncated) | 26,745 | {} | 2022-02-04 02:32:07 | |
| ¶ | pypath.inputs.uniprot.uniprot_preprocess |
Not calling `pypath.inputs.uniprot.uniprot_preprocess`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_recent_version |
Not calling `pypath.inputs.uniprot.uniprot_recent_version`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_taxonomy | 2022-02-04 02:32:07 | 2022-02-04 02:32:10 | 3.22 | dict | {'P00521': {'Abelson murine leukemia virus'}, 'P03333': {'Abelson murine leukemia virus'}, 'H8ZM73': {'Pinus balsamea', 'Balsam fir', 'Abies balsamea'}, 'H8ZM71': {'Pinus balsamea', 'Balsam fir', 'Abies balsamea'}, 'Q9MV51': {'Momi fir', 'Abies firma'}, 'O81086': {'Grand fir', 'Pinus grandis', 'Abie...(truncated) | 551,796 | {} | 2022-02-04 02:32:07 | |
| ¶ | pypath.inputs.uniprot.uniprot_tissues | 2022-02-04 02:32:11 | 2022-02-04 02:32:19 | 7.92 | dict | {'Q9GZX5': {UniprotTissue(tissue='Wide', level='undefined')}, 'Q9GZP7': {UniprotTissue(tissue='Olfactory mucosa', level='undefined'), UniprotTissue(tissue='Lung', level='low'), UniprotTissue(tissue='Brain', level='low'), UniprotTissue(tissue='Kidney', level='low')}, 'Q9NY84': {UniprotTissue(tissue='...(truncated) | 9,904 | {} | 2022-02-04 02:32:11 | |
| ¶ | pypath.inputs.uniprot.uniprot_topology | 2022-02-04 02:32:19 | 2022-02-04 02:32:43 | 24.31 | dict | {'Q9GZP7': {UniprotTopology(topology='Extracellular', start=1, end=56), UniprotTopology(topology='Extracellular', start=191, end=226), UniprotTopology(topology='Transmembrane', start=85, end=105), UniprotTopology(topology='Extracellular', start=296, end=303), UniprotTopology(topology='Cytoplasmic', ...(truncated) | 5,210 | {} | 2022-02-04 02:32:19 | |
| ¶ | pypath.inputs.uniprot.valid_uniprot |
Not calling `pypath.inputs.uniprot.valid_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.wang.get_hsn | 2022-02-04 02:32:43 | 2022-02-04 02:32:43 | 0.39 | list | [['1909', 'EDNRA', '4683', 'NBN', 'Pos'], ['7040', 'TGFB1', '7040', 'TGFB1', 'Neg'], ['9669', 'EIF5B', '6135', 'RPL11', 'Pos'], ['367', 'AR', '7337', 'UBE3A', 'Phy'], ['5291', 'PIK3CB', '57580', 'PREX1', 'Pos'], ['5568', 'PRKACG', '1499', 'CTNNB1', 'Pos'], ['156', 'ADRBK1', '155', 'ADRB3', 'Pos'], [...(truncated) | 62,937 | {} | 2022-02-04 02:32:43 | |
| ¶ | pypath.inputs.wang.wang_interactions | 2022-02-04 02:32:43 | 2022-02-04 02:32:44 | 0.43 | list | [['EDNRA', 'NBN', '+'], ['TGFB1', 'TGFB1', '-'], ['EIF5B', 'RPL11', '+'], ['AR', 'UBE3A', '0'], ['PIK3CB', 'PREX1', '+'], ['PRKACG', 'CTNNB1', '+'], ['ADRBK1', 'ADRB3', '+'], ['ITGA2B', 'ACTN4', '0'], ['MCM7', 'UBE3A', '-'], ['CD4', 'ITK', '+'], ['STAT3', 'MYC', '+'], ['ZBTB17', 'NDRG2', '-'], ['CSN...(truncated) | 62,937 | {} | 2022-02-04 02:32:43 | |
| ¶ | pypath.inputs.wojtowicz2020._id_translate |
Not calling `pypath.inputs.wojtowicz2020._id_translate`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.wojtowicz2020.wojtowicz2020_interactions | 2022-02-04 02:32:44 | 2022-02-04 02:32:45 | 1.54 | list | [Wojtowicz2020Interaction(id_a='P01889', id_b='Q96LC7'), Wojtowicz2020Interaction(id_a='Q8IWK6', id_b='Q96LC7'), Wojtowicz2020Interaction(id_a='Q9BWV1', id_b='P29460'), Wojtowicz2020Interaction(id_a='Q9BWV1', id_b='Q6PI73'), Wojtowicz2020Interaction(id_a='P17213', id_b='Q96A28'), Wojtowicz2020Intera...(truncated) | 483 | {} | 2022-02-04 02:32:44 | |
| ¶ | pypath.inputs.wojtowicz2020.wojtowicz2020_raw | 2022-02-04 02:32:45 | 2022-02-04 02:32:45 | 0.06 | list | [Wojtowicz2020RawRecord(prey_uniprot_name='1B35', bait_uniprot_name='SIG10', prey_common_name='HLA-B', bait_common_name='Siglec-10', prey_gene_name='HLA-B', bait_gene_name='SIGLEC10', prey_bait_replicate1_od650=0.1343, prey_bait_replicate2_od650=0.1416, prey_bait_replicate3_od650=0.1386, prey_contro...(truncated) | 495 | {} | 2022-02-04 02:32:45 | |
| ¶ | pypath.inputs.zhong2015.zhong2015_annotations | 2022-02-04 02:32:45 | 2022-02-04 02:32:46 | 0.20 | dict | {'P12830': {Zhong2015Annotation(type='iCAM')}, 'Q9Y6N8': {Zhong2015Annotation(type='iCAM')}, 'P55287': {Zhong2015Annotation(type='iCAM')}, 'P55290': {Zhong2015Annotation(type='iCAM')}, 'P55291': {Zhong2015Annotation(type='iCAM')}, 'O75309': {Zhong2015Annotation(type='iCAM')}, 'Q12864': {Zhong2015Ann...(truncated) | 466 | {} | 2022-02-04 02:32:45 |
The OmniPath Team • Saez Lab • 2022-02-04