Here we take a snapshot from the current tip of the master branch of pypath, collect all functions from the pypath.inputs module and run them with an empty cache directory. Basic metrics about the returned values and errors are presented. This simple and automatized procedure is able to reveal the most common errors: if a server is down, if the URL, format or access restrictions changed, or pypath got broken in the recent developments. Note: this report is only about pypath, not about the data in the OmniPath web service; before we build the OmniPath database, we aim to fix the errors which could have an impact on its content.
Compiled between 2022-04-09 00:13:02 and 2022-04-09 06:53:32; pypath version: 0.14.7 (from git; c907cbb )
| Modules collected: | 152 |
|---|---|
| Modules failed to import: | 0 |
| Functions collected: | 479 |
| Functions run without error: | 325 |
| Functions returned empty value: | 9 |
| Functions skipped due to lack of arguments: | 120 |
| Functions run with error: | 34 |
| Function | Started | Finished | Elapsed (s) | Result type | Result repr | Result size | Error | Change since last time | Last succeeded | |
|---|---|---|---|---|---|---|---|---|---|---|
| ¶ | pypath.inputs.abs.abs_interactions | 2022-04-09 00:13:07 | 2022-04-09 00:13:08 | 0.46 | list | [['SRF', 'extracted04'], ['SRF', 'extracted04'], ['SRF', 'extracted04'], ['TEF1', 'extracted04'], ['SP1', 'extracted04'], ['TBP', 'extracted04'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['SRF', 'X67686'], ['TEF1', 'X67686'], ['SP1', 'X67686'], ['TBP', 'X67686'], ['SRF', 'extracted05'], ['SRF', 'extrac...(truncated) | 650 | {} | 2022-04-09 00:13:07 | |
| ¶ | pypath.inputs.acsn.acsn_interactions | 2022-04-09 00:13:08 | 2022-04-09 00:13:09 | 1.68 | list | [AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CA', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454;15509806;16288288;17646672;18644865;20673124'), AcsnInteraction(partner_a='FOXO3', partner_b='PIK3CB', mechanism='CATALYSIS', references='10783894;11094066;11154281;11994454...(truncated) | 37,725 | {} | 2022-04-09 00:13:08 | |
| ¶ | pypath.inputs.acsn.acsn_interactions_sif | 2022-04-09 00:13:09 | 2022-04-09 00:13:10 | 0.75 | list | [['ACHE', 'UNKNOWN_CATALYSIS', 'Cytochrome'], ['ACHE', 'UNKNOWN_CATALYSIS', 'APAF1'], ['E2F1', 'null', 'MIR17-3P'], ['E2F1', 'null', 'p14ARF'], ['E2F1', 'null', 'BAF250'], ['E2F1', 'null', 'HDAC1'], ['E2F1', 'null', 'HP1gamma'], ['E2F1', 'null', 'RB1'], ['E2F1', 'null', 'SUV39H1'], ['E2F1', 'null', ...(truncated) | 9,570 | {} | 2022-04-09 00:13:09 | |
| ¶ | pypath.inputs.adhesome.adhesome_annotations | 2022-04-09 00:13:10 | 2022-04-09 00:15:43 | 153.18 | dict | {'P12814': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'P23528': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q9BR76': {AdhesomeAnnotation(mainclass='Actin regulation', intrinsic=True)}, 'Q14247': {AdhesomeAnnotation(mainclass='Actin regulation', intri...(truncated) | 239 | {} | 2022-04-09 00:13:10 | |
| ¶ | pypath.inputs.adhesome.adhesome_interactions | 2022-04-09 00:15:43 | 2022-04-09 00:17:54 | 131.04 | list | [AdhesomeInteraction(source='LPXN', target='GIT1', effect='0', type='Binding', pmid='12674328'), AdhesomeInteraction(source='GIT1', target='ARF1', effect='_', type='Inhibition', pmid='10896954'), AdhesomeInteraction(source='ARPC2', target='CTTN', effect='0', type='Binding', pmid='11018051'), Adhesom...(truncated) | 7,735 | {'size': 553} | 2022-04-09 00:15:43 | |
| ¶ | pypath.inputs.almen2009.almen2009_annotations | 2022-04-09 00:17:54 | 2022-04-09 00:17:58 | 4.15 | dict | {'P04839': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transmembrane=5, sosui_transmembrane=5, tmhmm_transmembrane=4)}, 'Q9Y5S8': {Almen2009Annotation(mainclass='Enzymes', classes=('1',), phobius_secreted=False, phobius_transmembrane=5, sosui_transmembra...(truncated) | 4,826 | {} | 2022-04-09 00:17:54 | |
| ¶ | pypath.inputs.baccin2019.baccin2019_annotations | 2022-04-09 00:17:58 | 2022-04-09 00:22:02 | 243.95 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 195, in baccin2019_annotations
ia_all = baccin2019_interactions(ncbi_tax_id = ncbi_tax_id)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 136, in baccin2019_interactions
ligand_components = raw_to_uniprots(rec[1])
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 83, in raw_to_uniprots
itertools.product(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 84, in <genexpr>
*(id_translate(comp) for comp in components)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 65, in id_translate
itertools.chain(*(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 66, in <genexpr>
homology_mod.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 500, in load
self.load_homologene(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 639, in load_homologene
hge = homologene_input.homologene_dict(source, self.target, 'entrez')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/homologene.py", line 93, in homologene_dict
for l in hg:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-04-01 00:17:12 | |||
| ¶ | pypath.inputs.baccin2019.baccin2019_interactions | 2022-04-09 00:22:02 | 2022-04-09 00:23:58 | 115.99 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 136, in baccin2019_interactions
ligand_components = raw_to_uniprots(rec[1])
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 83, in raw_to_uniprots
itertools.product(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 84, in <genexpr>
*(id_translate(comp) for comp in components)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 65, in id_translate
itertools.chain(*(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/baccin2019.py", line 66, in <genexpr>
homology_mod.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 500, in load
self.load_homologene(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 639, in load_homologene
hge = homologene_input.homologene_dict(source, self.target, 'entrez')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/homologene.py", line 93, in homologene_dict
for l in hg:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-04-01 00:28:22 | |||
| ¶ | pypath.inputs.biogps.biogps_datasets | 2022-04-09 00:23:58 | 2022-04-09 00:23:58 | 0.00 | list | [BiogpsDataset(organism='human', label='human_gene_atlas_ave', url='http://plugins.biogps.org/download/gnf1h-gcrma.zip'), BiogpsDataset(organism='human', label='human_gene_atlas', url='http://plugins.biogps.org/download/gnf1h-gcrma-unaveraged.zip'), BiogpsDataset(organism='human', label='human_nci60...(truncated) | 9 | {} | 2022-04-09 00:23:58 | |
| ¶ | pypath.inputs.biogps.biogps_download |
Not calling `pypath.inputs.biogps.biogps_download`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biogps.biogps_download_all | 2022-04-09 00:23:58 | 2022-04-09 00:30:11 | 372.99 | dict | {'human_gene_atlas_ave': probe B_lymphoblasts ... retina small_intestine 0 1007_s_at 137.00 ... 880.675 168.15 1 1053_at 81.75 ... 9.900 8.50 2 117_at 12.55 ...(truncated) | 9 | {} | 2022-04-09 00:23:58 | |
| ¶ | pypath.inputs.biogrid.biogrid_all_interactions | 2022-04-09 00:30:12 | 2022-04-09 00:37:58 | 465.52 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/biogrid.py", line 140, in biogrid_all_interactions
f = next(iter(c.result.values()))
AttributeError: 'NoneType' object has no attribute 'values'
|
{} | 2022-04-01 00:28:58 | |||
| ¶ | pypath.inputs.biogrid.biogrid_interactions | 2022-04-09 00:37:58 | 2022-04-09 00:37:59 | 0.98 | list | [BiogridPhysicalInteraction(partner_a='APOB', partner_b='MTTP', pmid='9915855'), BiogridPhysicalInteraction(partner_a='CAPN3', partner_b='TTN', pmid='9642272'), BiogridPhysicalInteraction(partner_a='DOCK8', partner_b='CDC42', pmid='15304341'), BiogridPhysicalInteraction(partner_a='CDKN3', partner_b=...(truncated) | 6,662 | {} | 2022-04-09 00:37:58 | |
| ¶ | pypath.inputs.biomart.biomart_homology | 2022-04-09 00:37:59 | 2022-04-09 00:38:59 | 60.39 | list | [EnsemblRecord(ensembl_gene_id='ENSG00000198888', ensembl_transcript_id='ENST00000361390', ensembl_peptide_id='ENSP00000354687', mmusculus_homolog_ensembl_peptide='ENSMUSP00000080991', mmusculus_homolog_ensembl_gene='ENSMUSG00000064341', mmusculus_homolog_orthology_type='ortholog_one2one', mmusculus...(truncated) | 174,615 | {} | 2022-04-09 00:37:59 | |
| ¶ | pypath.inputs.biomart.biomart_microarray |
Not calling `pypath.inputs.biomart.biomart_microarray`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biomart.biomart_microarray_types | 2022-04-09 00:38:59 | 2022-04-09 00:39:00 | 0.63 | list | [{'type': 'OLIGO', 'description': None, 'array': 'OneArray', 'vendor': 'PHALANX', 'format': 'EXPRESSION', 'label': 'PHALANX OneArray'}, {'format': 'EXPRESSION', 'vendor': 'CODELINK', 'array': 'CODELINK', 'type': 'OLIGO', 'description': None, 'label': 'CODELINK CODELINK'}, {'vendor': 'ILLUMINA', 'arr...(truncated) | 38 | {} | 2022-04-09 00:38:59 | |
| ¶ | pypath.inputs.biomart.biomart_query |
Not calling `pypath.inputs.biomart.biomart_query`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biomodels._get_biomodels | 2022-04-09 00:39:00 | 2022-04-09 00:39:00 | 0.00 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/biomodels.py", line 94, in _get_biomodels
loginurl = urls.urls['biomodels']['login'] % t
KeyError: 'login'
|
{} | 2022-03-20 00:29:08 | |||
| ¶ | pypath.inputs.biomodels.download_single_model |
Not calling `pypath.inputs.biomodels.download_single_model`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.biomodels.get_biomodels | 2022-04-09 00:39:00 | 2022-04-09 00:39:00 | 0.13 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/biomodels.py", line 159, in get_biomodels
token = json.loads(fp.read())['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-03-20 01:18:55 | |||
| ¶ | pypath.inputs.biomodels.get_biomodels_req | 2022-04-09 00:39:00 | 2022-04-09 00:39:01 | 0.57 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/biomodels.py", line 186, in get_biomodels_req
token = json.loads(r0.text)['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-03-20 01:18:55 | |||
| ¶ | pypath.inputs.biomodels.get_single_model |
Not calling `pypath.inputs.biomodels.get_single_model`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ca1.ca1_interactions | 2022-04-09 00:39:01 | 2022-04-09 00:39:04 | 2.52 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/ca1.py", line 57, in ca1_interactions
path = science_input.science_download(url = url)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/science.py", line 62, in science_download
c_init = curl.Curl(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 961, in __init__
self.process_file()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 1694, in process_file
self.extract_file()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 1724, in extract_file
self.extract()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 622, in extract
getattr(self, 'open_%s' % self.type)()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 739, in open_plain
self._log('Opening plain text file `%s`.' % self.fileobj.name)
AttributeError: 'NoneType' object has no attribute 'name'
|
{'broke': True} | 2022-04-03 00:38:19 | |||
| ¶ | pypath.inputs.cancercellmap.ccmap_interactions | 2022-04-09 00:39:04 | 2022-04-09 00:39:04 | 0.83 | list | [CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q96S28', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q86YA7', directed=False, references='15262978'), CancercellmapInteraction(source_uniprot='Q5VTT9', target_uniprot='Q4T...(truncated) | 47,644 | {} | 2022-04-09 00:39:04 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_annotations | 2022-04-09 00:39:04 | 2022-04-09 00:39:18 | 13.61 | defaultdict | defaultdict(<class 'set'>, {'46220502': {CancerDrugsAnnotation(label='Abemaciclib', indications='Advanced Breast Cancer; Metastatic Breast Cancer', last_updated='01/02/2022')}, '132971': {CancerDrugsAnnotation(label='Abiraterone', indications='Metastatic Castration Resistant Prostate Cancer', last_u...(truncated) | 199 | {} | 2022-04-09 00:39:04 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_download | 2022-04-09 00:39:18 | 2022-04-09 00:39:18 | 0.00 | list | [{'Product': 'Abemaciclib', 'EMA': 'Y', 'FDA': 'Y', 'EN': 'N', 'Other': '', 'WHO': 'N', 'Year': '2017', 'Generic': 'N', 'DrugBank ID': '<a href="https://go.drugbank.com/drugs/DB12001">DB12001</a>', 'ATC': 'L01EF03', 'ChEMBL': '<a href="https://www.ebi.ac.uk/chembl/compound_report_card/CHEMBL3301610"...(truncated) | 284 | {} | 2022-04-09 00:39:18 | |
| ¶ | pypath.inputs.cancerdrugs_db.cancerdrugs_db_interactions | 2022-04-09 00:39:18 | 2022-04-09 00:39:18 | 0.48 | list | [CancerDrugsInteraction(source={'46220502'}, target={'Q00534'}), CancerDrugsInteraction(source={'46220502'}, target={'P11802'}), CancerDrugsInteraction(source={'46220502'}, target={'P24385'}), CancerDrugsInteraction(source={'46220502'}, target={'P30281'}), CancerDrugsInteraction(source={'46220502'},...(truncated) | 2,864 | {} | 2022-04-09 00:39:18 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_annotations | 2022-04-09 00:39:18 | 2022-04-09 00:39:19 | 0.17 | dict | {'46220502': {CancerdrugsdbAnnotation(drug_label='Abemaciclib', ema_approved=True, fda_approved=True, european_national_approved=False, who_approved=False, generic=False, approval_year=2017, indications=('Advanced Breast Cancer', 'Metastatic Breast Cancer'))}, '132971': {CancerdrugsdbAnnotation(drug...(truncated) | 188 | {} | 2022-04-09 00:39:18 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_download | 2022-04-09 00:39:19 | 2022-04-09 00:39:19 | 0.00 | list | [{'Product': 'Abemaciclib', 'EMA': 'Y', 'FDA': 'Y', 'EN': 'N', 'Other': '', 'WHO': 'N', 'Year': '2017', 'Generic': 'N', 'DrugBank ID': '<a href="https://go.drugbank.com/drugs/DB12001">DB12001</a>', 'ATC': 'L01EF03', 'ChEMBL': '<a href="https://www.ebi.ac.uk/chembl/compound_report_card/CHEMBL3301610"...(truncated) | 284 | {} | 2022-04-09 00:39:19 | |
| ¶ | pypath.inputs.cancerdrugsdb.cancerdrugsdb_interactions | 2022-04-09 00:39:19 | 2022-04-09 00:39:19 | 0.16 | list | [CancerdrugsdbInteraction(drug_pubchem='46220502', drug_chembl='CHEMBL3301610', drug_drugbank='DB12001', drug_label='Abemaciclib', target_uniprot='P42771', ema_approved=True, fda_approved=True, european_national_approved=False, who_approved=False, generic=False, approval_year=2017, indications=('Adv...(truncated) | 2,378 | {} | 2022-04-09 00:39:19 | |
| ¶ | pypath.inputs.cancersea.cancersea_annotations | 2022-04-09 00:39:19 | 2022-04-09 00:39:21 | 1.72 | dict | {'P37023': {CancerseaAnnotation(state='Angiogenesis')}, 'P78504': {CancerseaAnnotation(state='Angiogenesis'), CancerseaAnnotation(state='Inflammation'), CancerseaAnnotation(state='Metastasis')}, 'Q15389': {CancerseaAnnotation(state='Angiogenesis')}, 'O15123': {CancerseaAnnotation(state='Angiogenesis...(truncated) | 1,247 | {} | 2022-04-09 00:39:19 | |
| ¶ | pypath.inputs.cell.cell_supplementary |
Not calling `pypath.inputs.cell.cell_supplementary`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellcall.cellcall_annotations | 2022-04-09 00:39:21 | 2022-04-09 00:39:33 | 12.67 | dict | {'P52803': {CellcallAnnotation(role='ligand')}, 'Q15375': {CellcallAnnotation(role='receptor')}, 'P01133': {CellcallAnnotation(role='ligand')}, 'P04626': {CellcallAnnotation(role='receptor')}, 'Q93097': {CellcallAnnotation(role='ligand')}, 'Q9ULV1': {CellcallAnnotation(role='receptor')}, 'O43927': {...(truncated) | 460 | {} | 2022-04-09 00:39:21 | |
| ¶ | pypath.inputs.cellcall.cellcall_download | 2022-04-09 00:39:33 | 2022-04-09 00:39:33 | 0.05 | list | [{'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '2626', 'Pathway': 'hsa04530_3,hsa04530_5', 'pathway_ID': 'hsa04530', 'Ligand_Symbol': 'OCLN', 'Receptor_Symbol': 'OCLN', 'TF_Symbol': 'GATA4'}, {'Ligand_ID': '100506658', 'Receptor_ID': '100506658', 'TF_ID': '8531', 'Pathway': 'hsa045...(truncated) | 19,144 | {} | 2022-04-09 00:39:33 | |
| ¶ | pypath.inputs.cellcall.cellcall_download_all | 2022-04-09 00:39:33 | 2022-04-09 00:39:34 | 1.06 | list | [{'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '16150', 'Pathway': 'hsa04062_5', 'pathway_ID': 'hsa04062', 'Ligand_Symbol': 'Cxcl13', 'Receptor_Symbol': 'Xcr1', 'TF_Symbol': 'Ikbkb', 'extended': True, 'organism': 10090}, {'Ligand_ID': '55985', 'Receptor_ID': '23832', 'TF_ID': '18033', 'Pat...(truncated) | 38,645 | {} | 2022-04-09 00:39:33 | |
| ¶ | pypath.inputs.cellcall.cellcall_interactions | 2022-04-09 00:39:34 | 2022-04-09 00:39:36 | 1.89 | list | [CellcallInteraction(ligand_uniprot='P52803', receptor_uniprot='Q15375', core=True), CellcallInteraction(ligand_uniprot='P01133', receptor_uniprot='P04626', core=True), CellcallInteraction(ligand_uniprot='Q93097', receptor_uniprot='Q9ULV1', core=True), CellcallInteraction(ligand_uniprot='O43927', re...(truncated) | 797 | {} | 2022-04-09 00:39:34 | |
| ¶ | pypath.inputs.cellcellinteractions.cellcellinteractions_annotations | 2022-04-09 00:39:36 | 2022-04-09 00:39:37 | 0.85 | dict | {'Q8IVN8': {CellcellinteractionsAnnotation(mainclass='Ligand'), CellcellinteractionsAnnotation(mainclass='Receptor'), CellcellinteractionsAnnotation(mainclass='ECM')}, 'O95967': {CellcellinteractionsAnnotation(mainclass='Ligand'), CellcellinteractionsAnnotation(mainclass='Receptor'), Cellcellinterac...(truncated) | 3,425 | {} | 2022-04-09 00:39:36 | |
| ¶ | pypath.inputs.cellchatdb._cellchatdb_organism | 2022-04-09 00:39:37 | 2022-04-09 00:39:37 | 0.00 | int | 9606 | 0 | {} | 2022-04-09 00:39:37 | |
| ¶ | pypath.inputs.cellchatdb._cellchatdb_process_cofactors |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_cofactors`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellchatdb._cellchatdb_process_complexes |
Not calling `pypath.inputs.cellchatdb._cellchatdb_process_complexes`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellchatdb.cellchatdb_annotations | 2022-04-09 00:39:37 | 2022-04-09 00:39:45 | 7.83 | dict | {'P01137': {CellChatDBAnnotation(role='ligand', pathway='TGFb', category='Secreted Signaling')}, Complex TGFbR1_R2: COMPLEX:P36897_P37173: {CellChatDBAnnotation(role='receptor', pathway='TGFb', category='Secreted Signaling')}, 'P07996': {CellChatDBAnnotation(role='agonist', pathway='TGFb', category=...(truncated) | 1,067 | {} | 2022-04-09 00:39:37 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_cofactors | 2022-04-09 00:39:45 | 2022-04-09 00:39:51 | 5.45 | dict | {'ACTIVIN antagonist': {'P19883'}, 'ACTIVIN inhibition receptor': {'Q13145'}, 'ANGPT inhibition receptor 1': {'P35590'}, 'ANGPT inhibition receptor 2': {'P23467'}, 'BMP antagonist': {'O60565', 'P41271', 'O75610', 'O00292', 'Q13253', 'Q9H772', 'Q9H2X0', 'P12645'}, 'BMP inhibition receptor': {'Q13145'...(truncated) | 31 | {} | 2022-04-09 00:39:45 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_complexes | 2022-04-09 00:39:51 | 2022-04-09 00:39:55 | 4.89 | dict | {'COMPLEX:P08476_P09529': Complex Activin AB: COMPLEX:P08476_P09529, 'COMPLEX:P05111_P08476': Complex Inhibin A: COMPLEX:P05111_P08476, 'COMPLEX:P05111_P09529': Complex Inhibin B: COMPLEX:P05111_P09529, 'COMPLEX:P29459_P29460': Complex IL12AB: COMPLEX:P29459_P29460, 'COMPLEX:P29460_Q9NPF7': Complex ...(truncated) | 153 | {} | 2022-04-09 00:39:51 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_download | 2022-04-09 00:39:55 | 2022-04-09 00:40:01 | 5.42 | dict | {'interaction': interaction_name ... rownames 0 TGFB1_TGFBR1_TGFBR2 ... TGFB1_TGFBR1_TGFBR2 1 TGFB2_TGFBR1_TGFBR2 ... TGFB2_TGFBR1_TGFBR2 2 TGFB3_TGFBR1_TGFBR2 ... TGFB3_TGFBR1_TGFBR2 3 TGFB1_ACVR1B_TGFBR2 ... TGFB1_ACVR1B_TGFBR2 4 TGFB1_ACVR1C_TGFBR...(truncated) | 4 | {} | 2022-04-09 00:39:55 | |
| ¶ | pypath.inputs.cellchatdb.cellchatdb_interactions | 2022-04-09 00:40:01 | 2022-04-09 00:40:06 | 5.28 | list | [CellChatDBInteraction(id_a='P01137', id_b=Complex TGFbR1_R2: COMPLEX:P36897_P37173, role_a='ligand', role_b='receptor', effect='unknown', pathway='TGFb', refs=[], category='Secreted Signaling'), CellChatDBInteraction(id_a='P07996', id_b='P01137', role_a='agonist', role_b='ligand', effect='stimulati...(truncated) | 11,113 | {} | 2022-04-09 00:40:01 | |
| ¶ | pypath.inputs.cellinker._cellinker_interactions_raw | 2022-04-09 00:40:06 | 2022-04-09 00:40:06 | 0.30 | list | [{'Ligand_id': '1000', 'Ligand_symbol': 'CDH2', 'Ligand_location': 'Membrane', 'Receptor_id': '1000', 'Receptor_symbol': 'CDH2', 'Receptor.location': 'Membrane', 'Type': 'Cell adhesion', 'KEGG.pathway': 'hsa04514:Cell adhesion molecules (CAMs)', 'Pmubmed.ID': '32196115', 'Other.DB': '', 'LRID': 'LR0...(truncated) | 3,744 | {} | 2022-04-09 00:40:06 | |
| ¶ | pypath.inputs.cellinker._cellinker_uniprots |
Not calling `pypath.inputs.cellinker._cellinker_uniprots`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellinker.cellinker_annotations | 2022-04-09 00:40:06 | 2022-04-09 00:40:07 | 0.89 | dict | {'P10153': {CellinkerAnnotation(role='ligand', location='Secreted', type='Secreted protein to receptor interaction')}, 'O60603': {CellinkerAnnotation(role='receptor', location='Membrane', type='ECM-receptor interaction'), CellinkerAnnotation(role='receptor', location='Membrane', type='Cell adhesion'...(truncated) | 1,921 | {} | 2022-04-09 00:40:06 | |
| ¶ | pypath.inputs.cellinker.cellinker_complex_annotations | 2022-04-09 00:40:07 | 2022-04-09 00:40:08 | 0.80 | dict | {Complex: COMPLEX:O75581_Q9NPG1: {CellinkerAnnotation(role='receptor', location='Membrane', type='Secreted protein to receptor interaction')}, Complex: COMPLEX:P17181_P48551: {CellinkerAnnotation(role='receptor', location='Membrane', type='Cytokine-cytokine receptor interaction'), CellinkerAnnotatio...(truncated) | 134 | {} | 2022-04-09 00:40:07 | |
| ¶ | pypath.inputs.cellinker.cellinker_complexes | 2022-04-09 00:40:08 | 2022-04-09 00:40:08 | 0.03 | dict | {'COMPLEX:O75462_Q9UBD9': Complex: COMPLEX:O75462_Q9UBD9, 'COMPLEX:P14770_P40197': Complex: COMPLEX:P14770_P40197, 'COMPLEX:P01857_P0CG04': Complex: COMPLEX:P01857_P0CG04, 'COMPLEX:P29460_Q9NPF7': Complex: COMPLEX:P29460_Q9NPF7, 'COMPLEX:P29459_Q8NEV9': Complex: COMPLEX:P29459_Q8NEV9, 'COMPLEX:Q0477...(truncated) | 143 | {} | 2022-04-09 00:40:08 | |
| ¶ | pypath.inputs.cellinker.cellinker_complexes_raw | 2022-04-09 00:40:08 | 2022-04-09 00:40:08 | 0.00 | list | [CellinkerComplex(role='ligand', cellinker_id='CH0131', components=(CellinkerComplexComponent(genesymbol='CRLF1', entrez='9244'), CellinkerComplexComponent(genesymbol='CLCF1', entrez='23529')), location='Secreted'), CellinkerComplex(role='ligand', cellinker_id='CH0132', components=(CellinkerComplexC...(truncated) | 145 | {} | 2022-04-09 00:40:08 | |
| ¶ | pypath.inputs.cellinker.cellinker_lr_interactions | 2022-04-09 00:40:08 | 2022-04-09 00:40:09 | 0.76 | set | {CellinkerInteraction(ligand='P10153', receptor='O60603', ligand_location='Secreted', receptor_location='Membrane', resources=None, pmids='18195069', type='Secreted protein to receptor interaction'), CellinkerInteraction(ligand='P08123', receptor='Q6GTX8', ligand_location='ECM', receptor_location='M...(truncated) | 3,812 | {} | 2022-04-09 00:40:08 | |
| ¶ | pypath.inputs.cellinker.cellinker_lr_interactions_raw | 2022-04-09 00:40:09 | 2022-04-09 00:40:09 | 0.01 | list | [{'Ligand_id': '1000', 'Ligand_symbol': 'CDH2', 'Ligand_location': 'Membrane', 'Receptor_id': '1000', 'Receptor_symbol': 'CDH2', 'Receptor.location': 'Membrane', 'Type': 'Cell adhesion', 'KEGG.pathway': 'hsa04514:Cell adhesion molecules (CAMs)', 'Pmubmed.ID': '32196115', 'Other.DB': '', 'LRID': 'LR0...(truncated) | 3,744 | {} | 2022-04-09 00:40:09 | |
| ¶ | pypath.inputs.cellinker.cellinker_protein_annotations | 2022-04-09 00:40:09 | 2022-04-09 00:40:10 | 0.78 | dict | {'P10153': {CellinkerAnnotation(role='ligand', location='Secreted', type='Secreted protein to receptor interaction')}, 'O60603': {CellinkerAnnotation(role='receptor', location='Membrane', type='ECM-receptor interaction'), CellinkerAnnotation(role='receptor', location='Membrane', type='Cell adhesion'...(truncated) | 1,787 | {} | 2022-04-09 00:40:09 | |
| ¶ | pypath.inputs.cellinker.cellinker_smol_interactions | 2022-04-09 00:40:10 | 2022-04-09 00:40:10 | 0.24 | set | {CellinkerInteraction(ligand='5280363', receptor='P34995', ligand_location=None, receptor_location='Membrane', resources='Guide2Pharma', pmids='10634944;11999132', type='sMOL-receptor interaction'), CellinkerInteraction(ligand='239', receptor='Q8TDS7', ligand_location=None, receptor_location='Membra...(truncated) | 314 | {} | 2022-04-09 00:40:10 | |
| ¶ | pypath.inputs.cellinker.cellinker_smol_interactions_raw | 2022-04-09 00:40:10 | 2022-04-09 00:40:10 | 0.00 | list | [{'ligand_pubchem_sid': '135651413', 'ligand_pubchem_cid': '5202', 'ligand name': '5-hydroxytryptamine', 'ligand_type': 'Metabolite', 'Receptor_id': '3350', 'Receptor_symbol': 'HTR1A', 'Receptor_uniprot': 'P08908', 'Receptor_location': 'Membrane', 'Type': 'sMOL-receptor interaction', 'target_species...(truncated) | 341 | {} | 2022-04-09 00:40:10 | |
| ¶ | pypath.inputs.cellinker.components_to_complex |
Not calling `pypath.inputs.cellinker.components_to_complex`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_annotations |
Not calling `pypath.inputs.cellphonedb._cellphonedb_annotations`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_get_entity |
Not calling `pypath.inputs.cellphonedb._cellphonedb_get_entity`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb._cellphonedb_hla |
Not calling `pypath.inputs.cellphonedb._cellphonedb_hla`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.cellphonedb.cellphonedb_complex_annotations | 2022-04-09 00:40:10 | 2022-04-09 00:40:10 | 0.22 | dict | {Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('receptor',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873: CellPhoneDBAnnotation(receptor=True, receptor_class=('...(truncated) | 112 | {} | 2022-04-09 00:40:10 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_complexes | 2022-04-09 00:40:10 | 2022-04-09 00:40:10 | 0.02 | dict | {'COMPLEX:P37023_Q13873': Complex ACVL1_BMPR2: COMPLEX:P37023_Q13873, 'COMPLEX:Q04771_Q13873': Complex ACVR1_BMPR2: COMPLEX:Q04771_Q13873, 'COMPLEX:P27037_Q04771': Complex ACVR_1A2A receptor: COMPLEX:P27037_Q04771, 'COMPLEX:Q04771_Q13705': Complex ACVR_1A2B receptor: COMPLEX:Q04771_Q13705, 'COMPLEX:...(truncated) | 112 | {} | 2022-04-09 00:40:10 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_interactions | 2022-04-09 00:40:10 | 2022-04-09 00:40:11 | 0.61 | list | [CellphonedbInteraction(id_a=Complex IL12: COMPLEX:P29459_P29460, id_b=Complex IL12 receptor: COMPLEX:P42701_Q99665, sources='CellPhoneDB', references='', interaction_type='ligand-receptor', type_a='ligand', type_b='receptor'), CellphonedbInteraction(id_a=Complex Activin ligand ab: COMPLEX:P08476_P0...(truncated) | 1,396 | {} | 2022-04-09 00:40:10 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_ligands_receptors | 2022-04-09 00:40:11 | 2022-04-09 00:40:11 | 0.07 | tuple | ({'P15248', 'Q9HD89', 'Q9NRJ3', Complex IL27: COMPLEX:Q14213_Q8NEV9, 'P48061', 'Q9H2X3', 'O43508', 'P01258', 'Q07325', 'P20827', 'P01583', 'Q8NFZ8', 'Q8NHW4', 'O60462', 'P16471', 'P23560', 'P0DJI8', 'P43490', 'Q08554', 'P14209', 'Q8N729', 'P01024', 'P13591', 'P01242', 'O14793', 'P05230', 'O14786', '...(truncated) | 2 | {} | 2022-04-09 00:40:11 | |
| ¶ | pypath.inputs.cellphonedb.cellphonedb_protein_annotations | 2022-04-09 00:40:11 | 2022-04-09 00:40:11 | 0.06 | dict | {'A4D1S0': CellPhoneDBAnnotation(receptor=True, receptor_class=('klr',), peripheral=False, secreted=False, secreted_class=(), transmembrane=True, integrin=False), 'A6NMZ7': CellPhoneDBAnnotation(receptor=False, receptor_class=(), peripheral=False, secreted=True, secreted_class=('secreted',), transme...(truncated) | 978 | {} | 2022-04-09 00:40:11 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_annotations | 2022-04-09 00:40:11 | 2022-04-09 00:40:24 | 12.54 | dict | {'Q13275': {CellTalkDBAnnotation(role='ligand', pmid='15721238'), CellTalkDBAnnotation(role='ligand', pmid='9883722'), CellTalkDBAnnotation(role='ligand', pmid='26156437')}, 'P51805': {CellTalkDBAnnotation(role='receptor', pmid='32196115'), CellTalkDBAnnotation(role='receptor', pmid='15721238')}, 'Q...(truncated) | 1,598 | {} | 2022-04-09 00:40:11 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_download | 2022-04-09 00:40:24 | 2022-04-09 00:40:24 | 0.00 | list | [CellTalkDbRecord(lr_pair='SEMA3F_PLXNA3', ligand_gene_symbol='SEMA3F', receptor_gene_symbol='PLXNA3', ligand_gene_id='6405', receptor_gene_id='55558', ligand_ensembl_protein_id='ENSP00000002829', receptor_ensembl_protein_id='ENSP00000358696', ligand_ensembl_gene_id='ENSG00000001617', receptor_ensem...(truncated) | 3,398 | {} | 2022-04-09 00:40:24 | |
| ¶ | pypath.inputs.celltalkdb.celltalkdb_interactions | 2022-04-09 00:40:24 | 2022-04-09 00:40:24 | 0.01 | list | [CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA3', reference='15721238'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='PLXNA1', reference='26156437'), CellTalkDBInteraction(ligand_genesymbol='SEMA3F', receptor_genesymbol='NRP1', reference='9883...(truncated) | 3,398 | {} | 2022-04-09 00:40:24 | |
| ¶ | pypath.inputs.celltypist.celltypist_annotations | 2022-04-09 00:40:24 | 2022-04-09 00:40:24 | 0.28 | dict | {'P15391': {CelltypistAnnotation(cell_type='B cells', cell_subtype='B cells', cell_ontology='CL:0000236', marker_type='curated_marker', tissues=('Blood', 'Eye', 'Intestine', 'Kidney', 'Liver', 'Lung', 'Thymus', 'Trachea'), datasets=('Braga et al. 2019', 'HCA Immune 2018', 'Martin et al. 2019', 'Mill...(truncated) | 424 | {'size': -50} | 2022-04-09 00:40:24 | |
| ¶ | pypath.inputs.compleat.compleat_complexes | 2022-04-09 00:40:24 | 2022-04-09 00:40:32 | 8.21 | dict | {'COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0': Complex: COMPLEX:O00161_O14662_O15400_O43752_O75379_P0CG48_P46459_P51809_P54920_Q12846_Q15836_Q8N1B4_Q96AJ9_Q9BV40_Q9UNK0, 'COMPLEX:O43681_O75396_P0CG48_P11441_Q7L5D6_Q8NEP3_Q96DZ5_Q9...(truncated) | 9,693 | {} | 2022-04-09 00:40:24 | |
| ¶ | pypath.inputs.compleat.compleat_raw | 2022-04-09 00:40:32 | 2022-04-09 00:40:32 | 0.05 | list | [{'compleat_id': 'HC4831', 'member_count': '15', 'predicted': 'Predicted', 'functions': 'protein transport', 'functions2': 'protein transport;cellular membrane fusion;Golgi vesicle transport;vesicle-mediated transport;intracellular transport', 'nothing': '', 'sources': 'NetworkBlast', 'name': '', 'm...(truncated) | 9,704 | {} | 2022-04-09 00:40:32 | |
| ¶ | pypath.inputs.complexportal.complexportal_complexes | 2022-04-09 00:40:32 | 2022-04-09 00:41:25 | 52.99 | dict | {'COMPLEX:P84022_Q13485_Q15796': Complex SMAD2-SMAD3-SMAD4 complex: COMPLEX:P84022_Q13485_Q15796, 'COMPLEX:P16220_P18848': Complex bZIP transcription factor complex, ATF4-CREB1: COMPLEX:P16220_P18848, 'COMPLEX:P18846_P18848': Complex bZIP transcription factor complex, ATF1-ATF4: COMPLEX:P18846_P1884...(truncated) | 1,261 | {} | 2022-04-09 00:40:32 | |
| ¶ | pypath.inputs.comppi.comppi_interaction_locations | 2022-04-09 00:41:25 | 2022-04-09 00:42:38 | 72.33 | list | [ComppiInteraction(id_a='Q8TES7', id_b='O75478', loc_a=(ComppiLocation(location='cytosol', score=0.8), ComppiLocation(location='nucleus', score=0.7)), loc_b=(ComppiLocation(location='nucleus', score=0.8),)), ComppiInteraction(id_a='Q8TES7', id_b='O75478', loc_a=(ComppiLocation(location='cytosol', sc...(truncated) | 591,078 | {} | 2022-04-09 00:41:25 | |
| ¶ | pypath.inputs.comppi.comppi_locations | 2022-04-09 00:42:38 | 2022-04-09 00:43:52 | 74.82 | dict | {'Q8TES7': {ComppiLocation(location='cytosol', score=0.8), ComppiLocation(location='membrane', score=0.96), ComppiLocation(location='cytosol', score=0.9099999999999999), ComppiLocation(location='cytosol', score=0.99997984), ComppiLocation(location='nucleus', score=0.9099999999999999), ComppiLocation...(truncated) | 18,209 | {} | 2022-04-09 00:42:38 | |
| ¶ | pypath.inputs.connectomedb.connectomedb_annotations | 2022-04-09 00:43:52 | 2022-04-09 00:43:53 | 0.53 | dict | {'P01023': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'Q07954': {ConnectomedbAnnotation(role='receptor', location='plasma membrane')}, 'Q16613': {ConnectomedbAnnotation(role='ligand', location='secreted')}, 'P48039': {ConnectomedbAnnotation(role='receptor', location='plasma membra...(truncated) | 1,428 | {} | 2022-04-09 00:43:52 | |
| ¶ | pypath.inputs.connectomedb.connectomedb_interactions | 2022-04-09 00:43:53 | 2022-04-09 00:43:53 | 0.02 | list | [ConnectomedbInteraction(ligand='A2M', ligand_location=['secreted'], receptor='LRP1', references=['1702392', '10652313', '12194978']), ConnectomedbInteraction(ligand='AANAT', ligand_location=['secreted'], receptor='MTNR1A', references=['12943195']), ConnectomedbInteraction(ligand='AANAT', ligand_loc...(truncated) | 2,293 | {} | 2022-04-09 00:43:53 | |
| ¶ | pypath.inputs.corum.corum_complexes | 2022-04-09 00:43:53 | 2022-04-09 00:43:54 | 0.79 | dict | {'COMPLEX:P41182_P56524': Complex BCL6-HDAC4 complex: COMPLEX:P41182_P56524, 'COMPLEX:P41182_Q9UQL6': Complex BCL6-HDAC5 complex: COMPLEX:P41182_Q9UQL6, 'COMPLEX:P41182_Q8WUI4': Complex BCL6-HDAC7 complex: COMPLEX:P41182_Q8WUI4, 'COMPLEX:Q09472_Q92793_Q92831_Q9Y6Q9': Complex Multisubunit ACTR coacti...(truncated) | 2,734 | {} | 2022-04-09 00:43:53 | |
| ¶ | pypath.inputs.cosmic.cancer_gene_census_annotations | 2022-04-09 00:43:54 | 2022-04-09 00:43:56 | 1.85 | dict | {'Q9NQ94': {CancerGeneCensusAnnotation(tier=2, hallmark=False, somatic=True, germline=False, tumour_types_somatic=('melanoma',), tumour_types_germline=(), cancer_syndrome=(), tissue_type=('E',), genetics=None, role=('oncogene',), mutation_type=('Mis',))}, 'Q8IZP0': {CancerGeneCensusAnnotation(tier=1...(truncated) | 726 | {} | 2022-04-09 00:43:54 | |
| ¶ | pypath.inputs.cpad.cpad_annotations | 2022-04-09 00:43:56 | 2022-04-09 00:44:01 | 5.57 | dict | {'Q16181': {CpadAnnotation(regulator_type='protein', effect_on_pathway='Upregulation', pathway='Actin cytoskeleton pathway', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='inhibit glioma cell migration', cancer='Glioma', pathway_category='Regulation of actin cytoskeleton')}, 'MIMAT0000431'...(truncated) | 1,038 | {} | 2022-04-09 00:43:56 | |
| ¶ | pypath.inputs.cpad.cpad_pathway_cancer | 2022-04-09 00:44:01 | 2022-04-09 00:44:01 | 0.05 | tuple | ({'Glioma': {CpadPathwayCancer(pathway='PAK5-Egr1-MMP2 signaling pathway', cancer='Glioma', pathway_category='Others', effect_on_cancer='Inhibiting', effect_on_cancer_outcome='inhibit glioma cell migration and invasion'), CpadPathwayCancer(pathway='EGFR signaling pathway', cancer='Glioma', pathway_c...(truncated) | 2 | {} | 2022-04-09 00:44:01 | |
| ¶ | pypath.inputs.cpad.get_cpad | 2022-04-09 00:44:01 | 2022-04-09 00:44:01 | 0.05 | list | [{'Regulator': 'NULL', 'Regulator_Type': 'NULL', 'Pathway': '5-LO/LTA4 hydrolase pathway', 'Pathway_Category': 'Others', 'KEGG_ID': 'NULL', 'Regulation_Type': 'Inhibiting', 'Cancer': 'Glioma', 'ID': 'H00042', 'Outcome_Description': 'partial suppression of tumor growth', 'Description': 'We confirmed ...(truncated) | 4,709 | {} | 2022-04-09 00:44:01 | |
| ¶ | pypath.inputs.cpdb.cpdb_interactions | 2022-04-09 00:44:01 | 2022-04-09 00:44:31 | 29.98 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 531,371 | {} | 2022-04-09 00:44:01 | |
| ¶ | pypath.inputs.cpdb.cpdb_interactions_ltp | 2022-04-09 00:44:32 | 2022-04-09 00:44:34 | 2.57 | list | [['SUMF2_HUMAN', 'SUMF1_HUMAN', 'Reactome', ''], ['ANPRA_HUMAN', 'ANF_HUMAN', 'PhosphoPOINT,Reactome,HPRD,Spike,Biogrid', '1660465,16713569,12547834'], ['ANFC_HUMAN', 'ANPRB_HUMAN', 'HPRD,Reactome,PhosphoPOINT,Biogrid', '1660465,12709393,1672777,1309330'], ['STIM1_HUMAN', 'TRPC1_HUMAN', 'DIP,Reactom...(truncated) | 482,222 | {} | 2022-04-09 00:44:32 | |
| ¶ | pypath.inputs.cspa.cspa_annotations | 2022-04-09 00:44:34 | 2022-04-09 00:44:36 | 1.71 | dict | {'P08473': {CspaAnnotation(high_confidence=True, n_cell_types=29, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q92854': {CspaAnnotation(high_confidence=True, n_cell_types=26, tm=1, gpi=0, uniprot_cell_surface=True)}, 'Q93033': {CspaAnnotation(high_confidence=True, n_cell_types=6, tm=1, gpi=0, uniprot_...(truncated) | 1,446 | {} | 2022-04-09 00:44:34 | |
| ¶ | pypath.inputs.cspa.cspa_cell_type_annotations | 2022-04-09 00:44:36 | 2022-04-09 00:44:40 | 3.80 | dict | {'A1A5B4': {CspaCellType(cell_type='SUDHL6', value=16.57829), CspaCellType(cell_type='HBL1', value=17.03274), CspaCellType(cell_type='ZL55', value=18.74705), CspaCellType(cell_type='A431', value=16.56885), CspaCellType(cell_type='NK', value=16.32343), CspaCellType(cell_type='HDLM2', value=16.69533),...(truncated) | 1,407 | {} | 2022-04-09 00:44:36 | |
| ¶ | pypath.inputs.cspa.cspa_cell_types | 2022-04-09 00:44:40 | 2022-04-09 00:44:43 | 2.53 | dict | {'A431': {'A1A5B4': 16.56885, 'A1A5C7': None, 'P0DN37': None, 'A0A0B4J2A2': None, 'A2RU67': None, 'A2VDJ0': None, 'A6NGN9': None, 'A6NI73': None, 'A6NKL6': None, 'A6NMZ7': 16.08666, 'A7MBM2': 15.11804, 'A8MVW0': None, 'A8MVW5': None, 'A8MWY0': None, 'A8TX70': None, 'O00116': None, 'O00206': 15.9843,...(truncated) | 47 | {} | 2022-04-09 00:44:40 | |
| ¶ | pypath.inputs.cytosig.cytosig_annotations | 2022-04-09 00:44:43 | 2022-04-09 00:45:05 | 22.92 | dict | {'Q9NPC4': {CytosigAnnotation(cytokine='P23560', score=0.0), CytosigAnnotation(cytokine='P05112', score=0.0859015527726121), CytosigAnnotation(cytokine='P22301', score=-0.0353693407415396), CytosigAnnotation(cytokine='P12644', score=-0.0353582633565803), CytosigAnnotation(cytokine='P01137', score=-0...(truncated) | 4,889 | {} | 2022-04-09 00:44:43 | |
| ¶ | pypath.inputs.cytosig.cytosig_df | 2022-04-09 00:45:06 | 2022-04-09 00:45:06 | 0.04 | DataFrame | Activin A BDNF BMP2 ... TWEAK VEGFA WNT3A A4GALT -0.135495 0.000000 -0.018502 ... 0.019689 -0.102361 0.013743 AAGAB 0.307167 0.074810 -0.070991 ... 0.077434 -0.009463 -0.005953 AAK1 -0.120398 -0.076692 -0.003144 ... -0.025428 0.020631 -0.045658 AAMDC ...(truncated) | 4,881 | {} | 2022-04-09 00:45:06 | |
| ¶ | pypath.inputs.dbptm.dbptm_enzyme_substrate | 2022-04-09 00:45:06 | 2022-04-09 00:45:09 | 2.78 | list | [{'substrate': 'P30443', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end': 116, 'instance': 'TLRGYYNQSEDGS', 'typ': 'n-linked glycosylation', 'source': 'Swiss-Prot', 'references': ['19159218']}, {'substrate': 'P01892', 'kinase': None, 'resnum': 110, 'resaa': 'N', 'start': 104, 'end':...(truncated) | 223,135 | {} | 2022-04-09 00:45:06 | |
| ¶ | pypath.inputs.dbptm.dbptm_enzyme_substrate_old | 2022-04-09 00:45:09 | 2022-04-09 00:45:13 | 4.23 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/dbptm.py", line 101, in dbptm_enzyme_substrate_old
for k, data in iteritems(extra):
File "/usr/lib/python3/dist-packages/future/utils/__init__.py", line 311, in iteritems
func = obj.items
AttributeError: 'NoneType' object has no attribute 'items'
|
{} | 2022-01-07 23:35:25 | |||
| ¶ | pypath.inputs.dbptm.dbptm_interactions | 2022-04-09 00:45:13 | 2022-04-09 00:45:15 | 1.42 | list | [['PKA', 'P63104', '11956222;12865427;15883165;16376338'], ['PKB', 'P63104', '11956222;12865427;15883165;16376338'], ['MAPK8', 'P63104', '15071501;15696159'], ['CDK1', 'P11171', '2171679;15525677;18220336;18669648'], ['MAPK1', 'Q13541', '12747827;17081983;17287340;18187866;18669648'], ['CK2', 'P0506...(truncated) | 2,071 | {} | 2022-04-09 00:45:13 | |
| ¶ | pypath.inputs.deathdomain.deathdomain_interactions | 2022-04-09 00:45:15 | 2022-04-09 00:45:16 | 1.24 | list | [] | 0 | {} | 2022-04-09 00:45:15 | |
| ¶ | pypath.inputs.deathdomain.deathdomain_interactions_rescued | 2022-04-09 00:45:16 | 2022-04-09 00:45:16 | 0.15 | list | [['Apaf1', 'Caspase9', 'GST fusion protein pull-down;In vitro purification protein assembly(Size-exclusion chromatography);Yeast two-hybrid;Co-immunoprecipitation;Size-exclusion chromatography;Structure;Gel filtration;β-galactosidase staining;DAPI staining;Caspase cleaved assay', '9390557;9922454;11...(truncated) | 184 | {} | 2022-04-09 00:45:16 | |
| ¶ | pypath.inputs.depod.depod_enzyme_substrate | 2022-04-09 00:45:16 | 2022-04-09 00:45:17 | 0.46 | list | [{'instance': None, 'kinase': 'P08575', 'resaa': 'Y', 'resnum': 1054, 'references': ['11201744'], 'substrate': 'P29597', 'start': None, 'end': None, 'typ': 'dephosphorylation'}, {'instance': None, 'kinase': 'P08575', 'resaa': 'Y', 'resnum': 1055, 'references': ['11201744'], 'substrate': 'P29597', 's...(truncated) | 537 | {} | 2022-04-09 00:45:16 | |
| ¶ | pypath.inputs.depod.depod_interactions | 2022-04-09 00:45:17 | 2022-04-09 00:45:17 | 0.01 | list | [('P15309', 'P04626', '11067847|9705354', '2', 'dephosphorylation reaction'), ('Q9BZG2', 'Q15303', '15219672', '1', 'dephosphorylation reaction'), ('P05186', 'P0C0S8', '6167574', '1', 'dephosphorylation reaction'), ('P05186', 'Q92934', 'PMC3005908', '1', 'dephosphorylation reaction'), ('P49593', 'Q1...(truncated) | 832 | {} | 2022-04-09 00:45:17 | |
| ¶ | pypath.inputs.dgidb.dgidb_annotations | 2022-04-09 00:45:17 | 2022-04-09 00:45:27 | 9.99 | dict | {'Q9BXS1': {DgidbAnnotation(category='ENZYME')}, 'Q9BZH6': {DgidbAnnotation(category='TRANSCRIPTION FACTOR')}, 'Q96Q89': {DgidbAnnotation(category='ENZYME')}, 'Q99470': {DgidbAnnotation(category='DRUGGABLE GENOME')}, 'Q9H211': {DgidbAnnotation(category='KINASE')}, 'O95069': {DgidbAnnotation(category...(truncated) | 10,493 | {} | 2022-04-09 00:45:17 | |
| ¶ | pypath.inputs.dgidb.get_dgidb_old | 2022-04-09 00:45:27 | 2022-04-09 00:46:41 | 74.33 | set | {'P49863', 'O43808', 'P0DTU4', 'Q8IUA7', 'Q9NRR5', 'Q6UDR6', 'Q9Y2T1', 'Q8WV44', 'P32780', 'Q9H3S4', 'Q15911', 'O15072', 'Q7RTP6', 'Q6IE38', 'P04626', 'Q9H1R3', 'Q05513', 'Q9Y5B0', 'Q8NGS3', 'Q9UI38', 'Q96KG9', 'Q96G74', 'Q9NQC7', 'P22891', 'Q8IYI0', 'P42772', 'Q03060', 'P01860', 'Q4G0N8', 'Q92614',...(truncated) | 5,900 | {} | 2022-04-09 00:45:27 | |
| ¶ | pypath.inputs.dip.dip_interactions | 2022-04-09 00:46:41 | 2022-04-09 00:46:41 | 0.35 | list | [['P01730', 'P01730', '9168119;9168119', 'direct interaction', 'x-ray crystallography;protein cross-linking with a bifunctional reagent', 'DIP-42E'], ['P29375', 'P06400', '8414517;22615382;22615382', 'physical interaction;physical association', 'biochemical;anti bait coimmunoprecipitation', 'DIP-214...(truncated) | 2,283 | {} | 2022-04-09 00:46:41 | |
| ¶ | pypath.inputs.dip.dip_login |
Not calling `pypath.inputs.dip.dip_login`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.disgenet.disgenet_annotations | 2022-04-09 00:46:41 | 2022-04-09 00:46:53 | 11.80 | dict | {'P04217': {DisGeNetAnnotation(disease='Hepatomegaly', type='phenotype', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',)), DisGeNetAnnotation(disease='Schizophrenia', type='disease', score=0.3, dsi=0.7, dpi=0.538, nof_pmids=1, nof_snps=0, source=('CTD_human',))}, 'P0102...(truncated) | 9,203 | {} | 2022-04-09 00:46:41 | |
| ¶ | pypath.inputs.domino.domino_ddi | 2022-04-09 00:46:53 | 2022-04-09 00:47:12 | 18.54 | list | [<pypath.internals.intera.DomainDomain object at 0x7feb9fd94ca0>, <pypath.internals.intera.DomainDomain object at 0x7feb9fd940a0>, <pypath.internals.intera.DomainDomain object at 0x7feb9fd945e0>, <pypath.internals.intera.DomainDomain object at 0x7feb9fd94940>, <pypath.internals.intera.DomainDomain o...(truncated) | 1,294 | {} | 2022-04-09 00:46:53 | |
| ¶ | pypath.inputs.domino.domino_enzsub | 2022-04-09 00:47:12 | 2022-04-09 00:47:13 | 1.01 | dict | {'ddi': [<pypath.internals.intera.DomainDomain object at 0x7febd5bdb550>, <pypath.internals.intera.DomainDomain object at 0x7febd5bdb9a0>, <pypath.internals.intera.DomainDomain object at 0x7feb98d93520>, <pypath.internals.intera.DomainDomain object at 0x7feb9c8c8370>, <pypath.internals.intera.Domain...(truncated) | 2 | {} | 2022-04-09 00:47:12 | |
| ¶ | pypath.inputs.domino.domino_interactions | 2022-04-09 00:47:13 | 2022-04-09 00:47:13 | 0.39 | list | [DominoRecord(uniprot_A='A4GZ26', uniprot_B='Q8BKX1', isoform_A='1', isoform_B='1', exp_method='two hybrid', references='10.1016/j.brainres.2008.11.061', taxon_A='10090', taxon_B='10090', role_A='physical association', role_B='unspecified role', binding_site_range_A='1424-1434', binding_site_range_B...(truncated) | 6,687 | {} | 2022-04-09 00:47:13 | |
| ¶ | pypath.inputs.domino.get_domino | 2022-04-09 00:47:13 | 2022-04-09 00:47:14 | 0.36 | list | [DominoRecord(uniprot_A='O00459', uniprot_B='', isoform_A='1', isoform_B='', exp_method='', references='', taxon_A='9606', taxon_B='', role_A='mint', role_B='neutral component', binding_site_range_A='4-80', binding_site_range_B='', domains_A='', domains_B='', ptm_residue_A='', ptm_residue_B='', ptm_...(truncated) | 14,539 | {} | 2022-04-09 00:47:13 | |
| ¶ | pypath.inputs.dorothea._process_resources |
Not calling `pypath.inputs.dorothea._process_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.dorothea.dorothea_full_raw | 2022-04-09 00:47:14 | 2022-04-09 00:47:21 | 7.80 | DataFrame | tf target mor ... which_inferred which_tfbs pubmed_id 0 ADNP AASDH 0.0 ... gtex none - 1 ADNP AASDHPPT 0.0 ... gtex none - 2 ADNP ABCB10 0.0 ... gtex none - 3 ADN...(truncated) | 1,019,220 | {} | 2022-04-09 00:47:14 | |
| ¶ | pypath.inputs.dorothea.dorothea_interactions | 2022-04-09 00:47:21 | 2022-04-09 00:47:35 | 13.59 | list | [DorotheaInteraction(tf='ADNP', target='ABCC1', effect=0, level='D', curated=False, chipseq=True, predicted=False, coexp=False, curated_sources='', chipseq_sources='ReMap', predicted_sources='', coexp_sources='', all_sources='ReMap', pubmed='', kegg_pathways=''), DorotheaInteraction(tf='ADNP', targe...(truncated) | 309,009 | {} | 2022-04-09 00:47:21 | |
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-04-09 00:47:35 | 2022-04-09 00:47:36 | 0.48 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-04-09 00:47:36 | 2022-04-09 00:47:36 | 0.29 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.dorothea.dorothea_rda_raw | 2022-04-09 00:47:36 | 2022-04-09 00:47:38 | 1.81 | DataFrame | tf confidence target mor 0 ADNP D ATF7IP 1.0 1 ADNP D DYRK1A 1.0 2 ADNP D TLK1 1.0 3 ADNP D ZMYM4 1.0 4 ADNP D ABCC1 1.0 ... ... ... ... ... 454499 ZZZ3 D ZBTB20 1.0 4545...(truncated) | 454,504 | {} | 2022-04-09 00:47:36 | |
| ¶ | pypath.inputs.dorothea.get_dorothea_old | 2022-04-09 00:47:38 | 2022-04-09 00:47:39 | 1.07 | list | [['AHR', 'CYP1A1', '0', 'A', True, False, True, False, 'HTRIdb,trrust_signed', '', 'hocomoco_v11', '', 'HTRIdb,trrust_signed,hocomoco_v11'], ['AHR', 'CYP1A2', '0', 'A', True, False, False, False, 'HTRIdb,trrust_signed', '', '', '', 'HTRIdb,trrust_signed'], ['AHR', 'CYP1B1', '0', 'A', True, False, Tr...(truncated) | 14,260 | {} | 2022-04-09 00:47:38 | |
| ¶ | pypath.inputs.dorothea.dorothea_rda_raw | 2022-04-09 00:47:39 | 2022-04-09 00:47:40 | 1.19 | DataFrame | tf confidence target mor 0 ADNP D ATF7IP 1.0 1 ADNP D DYRK1A 1.0 2 ADNP D TLK1 1.0 3 ADNP D ZMYM4 1.0 4 ADNP D ABCC1 1.0 ... ... ... ... ... 454499 ZZZ3 D ZBTB20 1.0 4545...(truncated) | 454,504 | {} | 2022-04-09 00:47:39 | |
| ¶ | pypath.inputs.dorothea.dorothea_interactions | 2022-04-09 00:47:40 | 2022-04-09 00:47:54 | 13.61 | list | [DorotheaInteraction(tf='ADNP', target='ABCC1', effect=0, level='D', curated=False, chipseq=True, predicted=False, coexp=False, curated_sources='', chipseq_sources='ReMap', predicted_sources='', coexp_sources='', all_sources='ReMap', pubmed='', kegg_pathways=''), DorotheaInteraction(tf='ADNP', targe...(truncated) | 309,009 | {} | 2022-04-09 00:47:40 | |
| ¶ | pypath.inputs.dorothea.dorothea_old_csv | 2022-04-09 00:47:54 | 2022-04-09 00:47:54 | 0.42 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/dorothea.py", line 213, in dorothea_old_csv
reader = csv.DictReader(c.result['database.csv'])
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-01-07 23:37:25 | |||
| ¶ | pypath.inputs.ebi.ebi_rest |
Not calling `pypath.inputs.ebi.ebi_rest`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.elm.elm_classes | 2022-04-09 00:47:54 | 2022-04-09 00:48:07 | 13.08 | dict | {'CLV_C14_Caspase3-7': ELMClass(accession='ELME000321', identifier='CLV_C14_Caspase3-7', functional_name='Caspase cleavage motif', description='Caspase-3 and Caspase-7 cleavage site.', regex='[DSTE][^P][^DEWHFYC]D[GSAN]', probability='0.00309374033071', n_instances='41', n_pdb='0'), 'CLV_MEL_PAP_1':...(truncated) | 317 | {} | 2022-04-09 00:47:54 | |
| ¶ | pypath.inputs.elm.elm_domains | 2022-04-09 00:48:07 | 2022-04-09 00:48:08 | 0.88 | dict | {'FZR_HUMAN': {'LIG_APCC_Dbox_1': [('218', '471')]}, 'BIRC3_HUMAN': {'LIG_BIR_II_1': [('172', '236')]}} | 2 | {} | 2022-04-09 00:48:07 | |
| ¶ | pypath.inputs.elm.elm_instances | 2022-04-09 00:48:08 | 2022-04-09 00:51:22 | 194.32 | list | [ELMInstance(accession='Accession', type='ELMType', identifier='ELMIdentifier', uniprot_id='ProteinName', uniprot='Primary_Acc', synonyms='Accessions', start='Start', end='End', references='References', methods='Methods', logic='InstanceLogic', pdb='PDB', organism='Organism'), ELMInstance(accession=...(truncated) | 3,935 | {'size': 1} | 2022-04-09 00:48:08 | |
| ¶ | pypath.inputs.elm.elm_interactions | 2022-04-09 00:51:22 | 2022-04-09 00:53:38 | 135.44 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/elm.py", line 181, in elm_interactions
uniprot_mofif, isoform_motif = reupi.match(l[2]).groups()
IndexError: tuple index out of range
|
{'broke': True} | 2022-04-03 00:49:26 | |||
| ¶ | pypath.inputs.embrace._embrace_id_translation |
Not calling `pypath.inputs.embrace._embrace_id_translation`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.embrace.embrace_annotations | 2022-04-09 00:53:38 | 2022-04-09 00:55:40 | 122.47 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 162, in embrace_annotations
for rec in embrace_translated(organism = organism):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 92, in embrace_translated
ligands = _embrace_id_translation(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 71, in _embrace_id_translation
uniprots = homology.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 500, in load
self.load_homologene(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 639, in load_homologene
hge = homologene_input.homologene_dict(source, self.target, 'entrez')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/homologene.py", line 93, in homologene_dict
for l in hg:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-04-01 00:41:13 | |||
| ¶ | pypath.inputs.embrace.embrace_interactions | 2022-04-09 00:55:40 | 2022-04-09 00:58:11 | 151.07 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 128, in embrace_interactions
for rec in embrace_translated(organism = organism)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 92, in embrace_translated
ligands = _embrace_id_translation(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/embrace.py", line 71, in _embrace_id_translation
uniprots = homology.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 1186, in translate
return manager.translate(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 257, in translate
table = self.which_table(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 171, in which_table
self.load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 202, in load
self.tables[key] = self._load(key)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 212, in _load
return ProteinHomology(
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 484, in __init__
self.load(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 500, in load
self.load_homologene(source)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/homology.py", line 639, in load_homologene
hge = homologene_input.homologene_dict(source, self.target, 'entrez')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/homologene.py", line 93, in homologene_dict
for l in hg:
TypeError: 'NoneType' object is not iterable
|
{'broke': True} | 2022-04-03 00:53:44 | |||
| ¶ | pypath.inputs.embrace.embrace_raw | 2022-04-09 00:58:11 | 2022-04-09 00:58:11 | 0.10 | list | [EmbraceRawRecord(ligand_symbol='A2m', receptor_symbol='Lrp1', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=0, N_receptor=1, P_receptor=0, M_receptor=1, EC_receptor=0), EmbraceRawRecord(ligand_symbol='Ace', receptor_symbol='Bdkrb2', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=1, N_receptor=0, P_r...(truncated) | 1,710 | {} | 2022-04-09 00:58:11 | |
| ¶ | pypath.inputs.embrace.embrace_translated | 2022-04-09 00:58:11 | 2022-04-09 01:09:27 | 675.90 | list | [EmbraceRawRecord(ligand_symbol='P01023', receptor_symbol='Q07954', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=0, N_receptor=1, P_receptor=0, M_receptor=1, EC_receptor=0), EmbraceRawRecord(ligand_symbol='P12821', receptor_symbol='P30411', N_ligand=1, P_ligand=0, M_ligand=0, EC_ligand=1, N_recepto...(truncated) | 1,775 | {} | 2022-04-09 00:58:11 | |
| ¶ | pypath.inputs.encode.encode_tf_mirna_interactions | 2022-04-09 01:09:27 | 2022-04-09 01:09:28 | 0.82 | list | [EncodeInteraction(tf_genesymbol='BDP1', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='RAD21', mirna='hsa-miR-92a-1*'), EncodeInteraction(tf_genesymbol='ESR1', mirna='hsa-miR-23b*'), EncodeInteraction(tf_genesymbol='BCL3', mirna='hsa-miR-19b-1*'), EncodeInteraction(tf_genesymbol='HEY1', ...(truncated) | 1,237 | {} | 2022-04-09 01:09:27 | |
| ¶ | pypath.inputs.ensembl.ensembl_organisms | 2022-04-09 01:09:28 | 2022-04-09 01:09:29 | 0.76 | list | [EnsemblOrganism(common_name='Abingdon island giant tortoise', scientific_name='Chelonoidis abingdonii', taxon_id=106734, ensembl_assembly='ASM359739v1', accession='GCA_003597395.1', genebuild_method='Full genebuild', variation_database='-', regulation_database='-', ensembl_name='cabingdonii'), Ense...(truncated) | 311 | {} | 2022-04-09 01:09:28 | |
| ¶ | pypath.inputs.exocarta._get_exocarta_vesiclepedia | 2022-04-09 01:09:29 | 2022-04-09 01:09:47 | 18.42 | list | [('967', 'CD63', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('1803', 'DPP4', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('79574', 'EPS8L3', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('55971', 'BAIAP2L1', 9606, ('11487543', (9606,), 'Intestinal e...(truncated) | 32,085 | {} | 2022-04-09 01:09:29 | |
| ¶ | pypath.inputs.exocarta.get_exocarta | 2022-04-09 01:09:47 | 2022-04-09 01:09:47 | 0.03 | list | [('967', 'CD63', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('1803', 'DPP4', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('79574', 'EPS8L3', 9606, ('11487543', (9606,), 'Intestinal epithelial cells')), ('55971', 'BAIAP2L1', 9606, ('11487543', (9606,), 'Intestinal e...(truncated) | 32,085 | {} | 2022-04-09 01:09:47 | |
| ¶ | pypath.inputs.exocarta.get_vesiclepedia | 2022-04-09 01:09:47 | 2022-04-09 01:10:57 | 69.79 | list | [('31848', 'His3.3B', 9606, ('16342139', (9606,), 'B cells', ('Microparticles',))), ('33736', 'His3.3A', 9606, ('16342139', (9606,), 'B cells', ('Microparticles',))), ('1', 'A1BG', 9606, ('19056867', (9606,), 'Urine', ('Exosomes',))), ('1', 'A1BG', 9606, ('21630462', (9606,), 'Ascites', ('Microvesic...(truncated) | 290,197 | {} | 2022-04-09 01:09:47 | |
| ¶ | pypath.inputs.genecards.genecards_datasheet |
Not calling `pypath.inputs.genecards.genecards_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.genecards.genecards_soup |
Not calling `pypath.inputs.genecards.genecards_soup`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.genecards.genecards_summaries |
Not calling `pypath.inputs.genecards.genecards_summaries`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.get_go_desc |
Not calling `pypath.inputs.go.get_go_desc`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.get_go_quick | 2022-04-09 01:10:57 | 2022-04-09 01:10:57 | 0.37 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 860, in get_go_quick
_ = next(c.result)
TypeError: 'NoneType' object is not an iterator
|
{} | 2022-01-07 23:44:17 | |||
| ¶ | pypath.inputs.go.get_goslim | 2022-04-09 01:10:57 | 2022-04-09 01:10:58 | 0.88 | list | ['GO:0000228', 'GO:0000278', 'GO:0000910', 'GO:0002181', 'GO:0002376', 'GO:0003012', 'GO:0003013', 'GO:0003014', 'GO:0003016', 'GO:0003677', 'GO:0003723', 'GO:0003774', 'GO:0003924', 'GO:0005198', 'GO:0005215', 'GO:0005576', 'GO:0005615', 'GO:0005618', 'GO:0005634', 'GO:0005635', 'GO:0005654', 'GO:0...(truncated) | 141 | {} | 2022-04-09 01:10:57 | |
| ¶ | pypath.inputs.go.go_ancestors_quickgo | 2022-04-09 01:10:58 | 2022-04-09 01:26:43 | 944.72 | dict | {'C': {'GO:0042612': {('GO:0042611', 'is_a')}, 'GO:0032398': {('GO:0042611', 'is_a')}, 'GO:0042613': {('GO:0042611', 'is_a')}, 'GO:0034359': {('GO:0042627', 'is_a')}, 'GO:0034360': {('GO:0042627', 'is_a')}, 'GO:0009426': {('GO:0030694', 'part_of'), ('GO:0110165', 'is_a')}, 'GO:0009429': {('GO:003069...(truncated) | 3 | {} | 2022-04-09 01:10:58 | |
| ¶ | pypath.inputs.go.go_ancestors_goose | 2022-04-09 01:26:43 | 2022-04-09 01:26:46 | 3.31 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 145, in go_ancestors_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:57:44 | |||
| ¶ | pypath.inputs.go.go_ancestors_quickgo | 2022-04-09 01:26:46 | 2022-04-09 01:26:50 | 3.49 | dict | {'C': {'GO:0042612': {('GO:0042611', 'is_a')}, 'GO:0032398': {('GO:0042611', 'is_a')}, 'GO:0042613': {('GO:0042611', 'is_a')}, 'GO:0034359': {('GO:0042627', 'is_a')}, 'GO:0034360': {('GO:0042627', 'is_a')}, 'GO:0009426': {('GO:0030694', 'part_of'), ('GO:0110165', 'is_a')}, 'GO:0009429': {('GO:003069...(truncated) | 3 | {} | 2022-04-09 01:26:46 | |
| ¶ | pypath.inputs.go.go_annotations_goa | 2022-04-09 01:26:50 | 2022-04-09 01:26:56 | 5.91 | dict | {'C': {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H8': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H9': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6I0': {'GO:0019814', 'G...(truncated) | 3 | {} | 2022-04-09 01:26:50 | |
| ¶ | pypath.inputs.go.go_annotations_goa | 2022-04-09 01:26:56 | 2022-04-09 01:26:57 | 1.07 | dict | {'C': {'A0A024RBG1': {'GO:0005737', 'GO:0005829', 'GO:0005634'}, 'A0A075B6H5': {'GO:0005886'}, 'A0A075B6H7': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H8': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6H9': {'GO:0019814', 'GO:0005615', 'GO:0005886'}, 'A0A075B6I0': {'GO:0019814', 'G...(truncated) | 3 | {} | 2022-04-09 01:26:56 | |
| ¶ | pypath.inputs.go.go_annotations_goose | 2022-04-09 01:26:57 | 2022-04-09 01:27:00 | 3.32 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 795, in go_annotations_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:57:55 | |||
| ¶ | pypath.inputs.go.go_annotations_solr | 2022-04-09 01:27:00 | 2022-04-09 01:27:01 | 1.01 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 681, in go_annotations_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
AttributeError: 'Curl' object has no attribute 'fileobj'
|
{} | 2022-01-07 23:57:58 | |||
| ¶ | pypath.inputs.go.go_annotations_uniprot | 2022-04-09 01:27:01 | 2022-04-09 01:27:31 | 29.58 | dict | {'Entry': ['Gene ontology IDs'], 'P51451': ['GO:0002431', 'GO:0002513', 'GO:0002576', 'GO:0002902', 'GO:0004712', 'GO:0004713', 'GO:0004715', 'GO:0005102', 'GO:0005524', 'GO:0005829', 'GO:0006974', 'GO:0007169', 'GO:0018108', 'GO:0030154', 'GO:0030889', 'GO:0031175', 'GO:0031234', 'GO:0032024', 'GO:...(truncated) | 20,377 | {} | 2022-04-09 01:27:01 | |
| ¶ | pypath.inputs.go.go_descendants_quickgo | 2022-04-09 01:27:31 | 2022-04-09 01:27:35 | 3.49 | dict | {'C': defaultdict(<class 'set'>, {'GO:0042611': {('GO:0042612', 'is_a'), ('GO:0032398', 'is_a'), ('GO:0042613', 'is_a')}, 'GO:0042627': {('GO:0034359', 'is_a'), ('GO:0034360', 'is_a')}, 'GO:0030694': {('GO:0009426', 'part_of'), ('GO:0009429', 'part_of')}, 'GO:0030689': {('GO:0030690', 'is_a'), ('GO:...(truncated) | 3 | {} | 2022-04-09 01:27:31 | |
| ¶ | pypath.inputs.go.go_descendants_goose | 2022-04-09 01:27:35 | 2022-04-09 01:27:38 | 3.22 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 222, in go_descendants_goose
anc = go_ancestors_goose(aspects = aspects)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 145, in go_ancestors_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:58:11 | |||
| ¶ | pypath.inputs.go.go_descendants_quickgo | 2022-04-09 01:27:38 | 2022-04-09 01:27:41 | 3.42 | dict | {'C': defaultdict(<class 'set'>, {'GO:0042611': {('GO:0042612', 'is_a'), ('GO:0032398', 'is_a'), ('GO:0042613', 'is_a')}, 'GO:0042627': {('GO:0034359', 'is_a'), ('GO:0034360', 'is_a')}, 'GO:0030694': {('GO:0009426', 'part_of'), ('GO:0009429', 'part_of')}, 'GO:0030689': {('GO:0030690', 'is_a'), ('GO:...(truncated) | 3 | {} | 2022-04-09 01:27:38 | |
| ¶ | pypath.inputs.go.go_descendants_to_ancestors |
Not calling `pypath.inputs.go.go_descendants_to_ancestors`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.go.go_terms_quickgo | 2022-04-09 01:27:41 | 2022-04-09 01:27:44 | 2.76 | dict | {'C': {'GO:0042613': 'MHC class II protein complex', 'GO:0042611': 'MHC protein complex', 'GO:0042612': 'MHC class I protein complex', 'GO:0042627': 'chylomicron', 'GO:0042629': 'mast cell granule', 'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:00306...(truncated) | 3 | {} | 2022-04-09 01:27:41 | |
| ¶ | pypath.inputs.go.go_terms_goose | 2022-04-09 01:27:44 | 2022-04-09 01:27:47 | 3.14 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 519, in go_terms_goose
for l in c.result:
TypeError: 'NoneType' object is not iterable
|
{} | 2022-01-07 23:58:20 | |||
| ¶ | pypath.inputs.go.go_terms_quickgo | 2022-04-09 01:27:47 | 2022-04-09 01:27:50 | 2.77 | dict | {'C': {'GO:0042613': 'MHC class II protein complex', 'GO:0042611': 'MHC protein complex', 'GO:0042612': 'MHC class I protein complex', 'GO:0042627': 'chylomicron', 'GO:0042629': 'mast cell granule', 'GO:0042622': 'photoreceptor outer segment membrane', 'GO:0030692': 'Noc4p-Nop14p complex', 'GO:00306...(truncated) | 3 | {} | 2022-04-09 01:27:47 | |
| ¶ | pypath.inputs.go.go_terms_solr | 2022-04-09 01:27:50 | 2022-04-09 01:27:51 | 0.61 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/go.py", line 377, in go_terms_solr
parser = etree.iterparse(c.fileobj, events = ('start', 'end'))
AttributeError: 'Curl' object has no attribute 'fileobj'
|
{} | 2022-01-07 23:58:26 | |||
| ¶ | pypath.inputs.gpcrdb.gpcrdb_annotations | 2022-04-09 01:27:51 | 2022-04-09 01:27:51 | 0.24 | dict | {'P08908': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28222': {GpcrdbAnnotation(gpcr_class='Class A (Rhodopsin)', family='Aminergic receptors', subfamily='5-Hydroxytryptamine receptors')}, 'P28221': {GpcrdbAnnotati...(truncated) | 402 | {} | 2022-04-09 01:27:51 | |
| ¶ | pypath.inputs.graphviz.graphviz_attrs | 2022-04-09 01:27:51 | 2022-04-09 01:27:52 | 0.98 | tuple | ({'_background': {'type': 'string', 'default': '<none>', 'min': '', 'notes': ''}, 'bb': {'type': 'rect', 'default': '', 'min': '', 'notes': 'write only'}, 'bgcolor': {'type': 'colorcolorList', 'default': '<none>', 'min': '', 'notes': ''}, 'center': {'type': 'bool', 'default': 'false', 'min': '', 'no...(truncated) | 3 | {} | 2022-04-09 01:27:51 | |
| ¶ | pypath.inputs.guide2pharma.guide2pharma_complexes |
Not calling `pypath.inputs.guide2pharma.guide2pharma_complexes`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.guide2pharma.guide2pharma_download | 2022-04-09 01:27:52 | 2022-04-09 01:28:02 | 10.58 | tuple | ([GuideToPharmacologyInteraction(ligand='TNFSF9', ligand_id_type='genesymbol', target='Q07011', target_id_type='uniprot', target_is_ligand=False, ligand_organism=9606, target_organism=9606, effect=0, ligand_location=None, target_type=None, ligand_endogenous=True, pubmed_ids=[]), GuideToPharmacologyI...(truncated) | 2 | {} | 2022-04-09 01:27:52 | |
| ¶ | pypath.inputs.guide2pharma.guide2pharma_interactions |
Not calling `pypath.inputs.guide2pharma.guide2pharma_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.havugimana.get_havugimana | 2022-04-09 01:28:02 | 2022-04-09 01:28:06 | 3.60 | list | [['C_1', '2.0', 'O60547,P30043', 'GMDS_HUMAN,BLVRB_HUMAN', '0.0', 'O60547,P30043,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'Fungi'], ['C_2', '2.0', 'Q92785,Q9NVP1', 'REQU_HUMAN,DDX18_HUMAN', '0.0', 'Q92785,Q9NVP1,', '-', '-', '-', '-', '-', '-', '-', '-', '-', 'vertebrates'], ['C_3', '2.0', 'Q...(truncated) | 622 | {} | 2022-04-09 01:28:02 | |
| ¶ | pypath.inputs.havugimana.havugimana_complexes | 2022-04-09 01:28:06 | 2022-04-09 01:28:06 | 0.04 | dict | {'COMPLEX:O60547_P30043': Complex: COMPLEX:O60547_P30043, 'COMPLEX:Q92785_Q9NVP1': Complex: COMPLEX:Q92785_Q9NVP1, 'COMPLEX:O95249_Q86Y82': Complex: COMPLEX:O95249_Q86Y82, 'COMPLEX:P26583_Q9UPN6': Complex: COMPLEX:P26583_Q9UPN6, 'COMPLEX:P15408_P18846': Complex: COMPLEX:P15408_P18846, 'COMPLEX:P2325...(truncated) | 622 | {} | 2022-04-09 01:28:06 | |
| ¶ | pypath.inputs.hgnc.hgnc_genegroups | 2022-04-09 01:28:06 | 2022-04-09 01:28:16 | 9.56 | dict | {'P04217': {HGNCGeneGroupAnnotation(mainclass='Immunoglobulin like domain containing')}, 'Q9NQ94': {HGNCGeneGroupAnnotation(mainclass='RNA binding motif containing')}, 'P01023': {HGNCGeneGroupAnnotation(mainclass='C3 and PZP like, alpha-2-macroglobulin domain containing')}, 'A8K2U0': {HGNCGeneGroupA...(truncated) | 15,002 | {'size': 6} | 2022-04-09 01:28:06 | |
| ¶ | pypath.inputs.hippie.hippie_interactions | 2022-04-09 01:28:16 | 2022-04-09 01:28:52 | 36.29 | list | [HippieInteraction(id_a='Q6K0P9', id_b='Q93009', score=0.82, methods=None, references=('25665578', '28077445'), sources=None, organisms=None), HippieInteraction(id_a='Q9NWA0', id_b='Q15648', score=0.88, methods=None, references=('14638676', '15175163', '20098423', '24882805', '27684187', '28514442')...(truncated) | 39,727 | {} | 2022-04-09 01:28:16 | |
| ¶ | pypath.inputs.homologene.get_homologene | 2022-04-09 01:28:52 | 2022-04-09 01:28:52 | 0.11 | list | ['3\t9606\t34\tACADM\t4557231\tNP_000007.1\n', '3\t9598\t469356\tACADM\t160961497\tNP_001104286.1\n', '3\t9544\t705168\tACADM\t109008502\tXP_001101274.1\n', '3\t9615\t490207\tACADM\t545503811\tXP_005622188.1\n', '3\t9913\t505968\tACADM\t115497690\tNP_001068703.1\n', '3\t10090\t11364\tAcadm\t6680618\...(truncated) | 865,559 | {'size': 14030} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.homologene.homologene_dict |
Not calling `pypath.inputs.homologene.homologene_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.homologene.homologene_uniprot_dict |
Not calling `pypath.inputs.homologene.homologene_uniprot_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.hpmr.get_hpmr | 2022-04-09 01:28:52 | 2022-04-09 01:28:52 | 0.00 | dict | {'interactions': [['P26992', 'Receptor', 'P40189', '15051883'], ['P26992', 'Receptor', 'P42702', '15051883'], ['P26992', 'Ligand', 'P00491', '15051883'], ['O75462', 'Receptor', 'P26992', '10966616'], ['O75462', 'Receptor', 'P40189', '10966616'], ['O75462', 'Receptor', 'P42702', '10966616'], ['O75462...(truncated) | 3 | {} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.hpmr.hpmr_annotations | 2022-04-09 01:28:52 | 2022-04-09 01:28:52 | 0.00 | dict | {'P26992': {HPMRAnnotation(role='Receptor', mainclass='Cytokine Type 1 receptors', subclass='CICYTR (Cytokine Type 1 receptors)', subsubclass=None)}, 'P40189': {HPMRAnnotation(role='Receptor', mainclass='Cytokine Type 1 receptors', subclass='OSMR(Cytokine Type 1 receptors)', subsubclass=None)}, 'P42...(truncated) | 1,141 | {} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.hpmr.hpmr_complexes | 2022-04-09 01:28:52 | 2022-04-09 01:28:52 | 0.00 | dict | {} | 0 | {} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.hpmr.hpmr_interactions | 2022-04-09 01:28:52 | 2022-04-09 01:28:52 | 0.00 | list | [['P26992', 'Receptor', 'P40189', '15051883'], ['P26992', 'Receptor', 'P42702', '15051883'], ['P26992', 'Ligand', 'P00491', '15051883'], ['O75462', 'Receptor', 'P26992', '10966616'], ['O75462', 'Receptor', 'P40189', '10966616'], ['O75462', 'Receptor', 'P42702', '10966616'], ['O75462', 'Ligand', 'P26...(truncated) | 619 | {} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.hprd.get_hprd | 2022-04-09 01:28:52 | 2022-04-09 01:29:22 | 29.50 | list | [['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '128', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '91', 'K', '-', '-', 'Acetylation', 'in vivo', '19608861'], ['00001', 'ALDH1A1', '00001_1', 'NP_000680.2', '353', 'K', '-', '-', 'Acetylation', ...(truncated) | 86,981 | {} | 2022-04-09 01:28:52 | |
| ¶ | pypath.inputs.hprd.hprd_enzyme_substrate | 2022-04-09 01:29:22 | 2022-04-09 01:29:23 | 1.60 | list | [{'resaa': 'Y', 'resnum': 12, 'typ': 'dephosphorylation', 'references': ['16291744'], 'kinase': 'PTPN1', 'substrate_refseqp': 'NP_001093.1', 'substrate': 'ACTN1', 'start': 5, 'end': 19, 'instance': None}, {'resaa': 'Y', 'resnum': 705, 'typ': 'phosphorylation', 'references': ['11940572', '11294897', ...(truncated) | 4,671 | {} | 2022-04-09 01:29:22 | |
| ¶ | pypath.inputs.hprd.hprd_interactions | 2022-04-09 01:29:23 | 2022-04-09 01:29:25 | 1.44 | list | [['00020', 'ACTN1', '00020_1', 'NP_001093.1', '12', 'Y', 'PTPN1', '01477', 'Dephosphorylation', 'in vitro;in vivo', '16291744'], ['00026', 'STAT3', '00026_1', 'NP_644805.1', '705', 'Y', 'FGFR3', '00624', 'Phosphorylation', 'in vivo', '11940572,11294897,10918587,12244095,11350938,12626508,8626374,125...(truncated) | 4,671 | {} | 2022-04-09 01:29:23 | |
| ¶ | pypath.inputs.hprd.hprd_interactions_htp | 2022-04-09 01:29:25 | 2022-04-09 01:29:26 | 1.32 | list | [['ALDH1A1', '00001', 'NP_000680.2', 'ALDH1A1', '00001', 'NP_000680.2', 'in vivo;yeast 2-hybrid', '12081471,16189514'], ['ITGA7', '02761', 'NP_001138468.1', 'CHRNA1', '00007', 'NP_001034612.1', 'in vivo', '10910772'], ['PPP1R9A', '16000', 'NP_060120.2', 'ACTG1', '00017', 'NP_001605.1', 'in vitro;in ...(truncated) | 39,241 | {} | 2022-04-09 01:29:25 | |
| ¶ | pypath.inputs.htri.htri_interactions | 2022-04-09 01:29:26 | 2022-04-09 01:29:30 | 3.39 | list | [HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='142', genesymbol_tf='PARP1', entrez_target='675', genesymbol_target='BRCA2', pubmed='18990703'), HTRIInteraction(entrez_tf='196', genesymbol_tf='AHR...(truncated) | 18,630 | {} | 2022-04-09 01:29:26 | |
| ¶ | pypath.inputs.humancellmap.humancellmap_annotations | 2022-04-09 01:29:30 | 2022-04-09 01:29:32 | 2.41 | dict | {'Q9NRG9': {HumancellmapAnnotation(localization='mitochondrial outer membrane', method='NMF'), HumancellmapAnnotation(localization='peroxisome', method='NMF'), HumancellmapAnnotation(localization='nuclear outer membrane-ER membrane network', method='SAFE')}, 'Q2M2I8': {HumancellmapAnnotation(localiz...(truncated) | 4,371 | {} | 2022-04-09 01:29:30 | |
| ¶ | pypath.inputs.humap.humap2_complexes | 2022-04-09 01:29:32 | 2022-04-09 01:29:36 | 4.19 | dict | {'COMPLEX:O95900_Q9BQS8': Complex: COMPLEX:O95900_Q9BQS8, 'COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9': Complex: COMPLEX:P08133_P68402_Q15102_Q15797_Q99426_Q9H4M9, 'COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6ZRY4_Q93062_Q96S66_Q9NZC3_Q9UF11_Q9Y6M7': Complex: COMPLEX:A1KXE4_O43251_Q15038_Q15434_Q6Z...(truncated) | 6,942 | {} | 2022-04-09 01:29:32 | |
| ¶ | pypath.inputs.humap.humap_complexes | 2022-04-09 01:29:36 | 2022-04-09 01:29:38 | 1.91 | dict | {'COMPLEX:Q7L523_Q8NBW4_Q9HB90': Complex: COMPLEX:Q7L523_Q8NBW4_Q9HB90, 'COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3': Complex: COMPLEX:O75478_O75528_Q8IYH5_Q92830_Q92831_Q9H8E8_Q9ULM3, 'COMPLEX:P31942_Q32P51': Complex: COMPLEX:P31942_Q32P51, 'COMPLEX:P35606_Q9NTJ5_Q9UBF2': Complex: COM...(truncated) | 4,499 | {} | 2022-04-09 01:29:36 | |
| ¶ | pypath.inputs.huri._huri_interactions |
Not calling `pypath.inputs.huri._huri_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.huri.hi_i_interactions | 2022-04-09 01:29:38 | 2022-04-09 01:29:51 | 12.66 | list | [HuriInteraction(uniprot_a='Q8IY31', uniprot_b='Q9BQD3', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='P49902', uniprot_b='P49902', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q9BVJ6', uniprot_b='Q8NHQ1', isoform_a=1, isoform_b=1, score=None), HuriInteractio...(truncated) | 5,676 | {} | 2022-04-09 01:29:38 | |
| ¶ | pypath.inputs.huri.hi_ii_interactions | 2022-04-09 01:29:51 | 2022-04-09 01:30:55 | 64.44 | list | [HuriInteraction(uniprot_a='Q9H2A7', uniprot_b='Q6UY14', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q5SY16', uniprot_b='Q09666', isoform_a=1, isoform_b=2, score=None), HuriInteraction(uniprot_a='P59797', uniprot_b='Q8NF64', isoform_a=1, isoform_b=3, score=None), HuriInteractio...(truncated) | 46,898 | {} | 2022-04-09 01:29:51 | |
| ¶ | pypath.inputs.huri.hi_iii_old | 2022-04-09 01:30:55 | 2022-04-09 01:30:55 | 0.00 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/huri.py", line 94, in hi_iii_old
url = urls.urls['hid']['hi-iii']
KeyError: 'hi-iii'
|
{} | 2022-01-08 00:02:33 | |||
| ¶ | pypath.inputs.huri.hi_union_interactions | 2022-04-09 01:30:55 | 2022-04-09 01:36:55 | 360.02 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/huri.py", line 302, in _huri_interactions
c = curl.FileOpener(path)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 592, in __init__
self.extract()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 622, in extract
getattr(self, 'open_%s' % self.type)()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 739, in open_plain
self._log('Opening plain text file `%s`.' % self.fileobj.name)
AttributeError: 'NoneType' object has no attribute 'name'
|
{} | 2022-04-01 01:00:17 | |||
| ¶ | pypath.inputs.huri.huri_interactions | 2022-04-09 01:36:55 | 2022-04-09 01:42:55 | 360.03 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/huri.py", line 302, in _huri_interactions
c = curl.FileOpener(path)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 592, in __init__
self.extract()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 622, in extract
getattr(self, 'open_%s' % self.type)()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/share/curl.py", line 739, in open_plain
self._log('Opening plain text file `%s`.' % self.fileobj.name)
AttributeError: 'NoneType' object has no attribute 'name'
|
{} | 2022-04-01 01:01:43 | |||
| ¶ | pypath.inputs.huri.lit_bm_13_interactions | 2022-04-09 01:42:55 | 2022-04-09 01:42:57 | 1.87 | list | [LitBm13Interaction(entrez_a='4790', entrez_b='79155', genesymbol_a='NFKB1', genesymbol_b='TNIP2'), LitBm13Interaction(entrez_a='7879', entrez_b='83547', genesymbol_a='RAB7A', genesymbol_b='RILP'), LitBm13Interaction(entrez_a='3932', entrez_b='80306', genesymbol_a='LCK', genesymbol_b='MED28'), LitBm...(truncated) | 11,045 | {} | 2022-04-09 01:42:55 | |
| ¶ | pypath.inputs.huri.lit_bm_17_interactions | 2022-04-09 01:42:57 | 2022-04-09 01:43:13 | 16.31 | list | [LitBm17Interaction(id_a='P07359', id_b='P13224', pubmed='18789323', score=0.659), LitBm17Interaction(id_a='P07359', id_b='P13224', pubmed='18674540', score=0.659), LitBm17Interaction(id_a='P63104', id_b='P13224', pubmed='10627461', score=0.702), LitBm17Interaction(id_a='P63104', id_b='P13224', pubm...(truncated) | 48,796 | {} | 2022-04-09 01:42:57 | |
| ¶ | pypath.inputs.huri.lit_bm_interactions | 2022-04-09 01:43:13 | 2022-04-09 01:45:07 | 113.63 | list | [LitBmInteraction(uniprot_a='P23511', uniprot_b='Q13952'), LitBmInteraction(uniprot_a='P23511', uniprot_b='P25208'), LitBmInteraction(uniprot_a='P43351', uniprot_b='P43351'), LitBmInteraction(uniprot_a='Q92934', uniprot_b='Q92843'), LitBmInteraction(uniprot_a='Q92934', uniprot_b='Q07817'), LitBmInte...(truncated) | 13,686 | {} | 2022-04-09 01:43:13 | |
| ¶ | pypath.inputs.huri.rolland_hi_ii_14 | 2022-04-09 01:45:07 | 2022-04-09 01:45:10 | 3.38 | list | [['14', '6293', 'AAMP', 'VPS52', '1'], ['14', '8553', 'AAMP', 'BHLHE40', '1'], ['14', '64782', 'AAMP', 'AEN', '2'], ['15', '4188', 'AANAT', 'MDFI', '1'], ['15', '8553', 'AANAT', 'BHLHE40', '1'], ['28', '65983', 'ABO', 'GRAMD3', '2'], ['28', '84283', 'ABO', 'TMEM79', '1'], ['39', '39', 'ACAT2', 'ACAT...(truncated) | 13,944 | {} | 2022-04-09 01:45:07 | |
| ¶ | pypath.inputs.huri.vidal_hi_iii_old |
Not calling `pypath.inputs.huri.vidal_hi_iii_old`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.huri.yang2016_interactions | 2022-04-09 01:45:10 | 2022-04-09 01:45:22 | 12.05 | list | [HuriInteraction(uniprot_a='P07196', uniprot_b='Q9BQQ3', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='O94989', uniprot_b='Q53EZ4', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q8NHQ1', uniprot_b='Q9H7H0', isoform_a=1, isoform_b=1, score=None), HuriInteractio...(truncated) | 2,829 | {} | 2022-04-09 01:45:10 | |
| ¶ | pypath.inputs.huri.yu2011_interactions | 2022-04-09 01:45:22 | 2022-04-09 01:45:39 | 16.63 | list | [HuriInteraction(uniprot_a='Q5VUM1', uniprot_b='O43889', isoform_a=1, isoform_b=2, score=None), HuriInteraction(uniprot_a='P62166', uniprot_b='Q86UW9', isoform_a=1, isoform_b=1, score=None), HuriInteraction(uniprot_a='Q9NV12', uniprot_b='O43889', isoform_a=1, isoform_b=2, score=None), HuriInteractio...(truncated) | 7,381 | {} | 2022-04-09 01:45:22 | |
| ¶ | pypath.inputs.i3d.get_i3d | 2022-04-09 01:45:39 | 2022-04-09 01:46:23 | 43.42 | list | [{'A0A024RAV5': {'pfam': None, 'chain': 'B', 'seq': [[1, 185]]}, 'P02647': {'pfam': None, 'chain': 'A', 'seq': [[68, 265]]}, 'uniprots': ['A0A024RAV5', 'P02647'], 'source': 'I3D', 'pdb': ['2mse'], 'references': []}, {'A0A024RAV5': {'pfam': None, 'chain': 'B', 'seq': [[1, 185]]}, 'P10398': {'pfam': N...(truncated) | 15,984 | {} | 2022-04-09 01:45:39 | |
| ¶ | pypath.inputs.icellnet._icellnet_get_components |
Not calling `pypath.inputs.icellnet._icellnet_get_components`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_entity |
Not calling `pypath.inputs.icellnet._icellnet_get_entity`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_references |
Not calling `pypath.inputs.icellnet._icellnet_get_references`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet._icellnet_get_resources |
Not calling `pypath.inputs.icellnet._icellnet_get_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.icellnet.icellnet_annotations | 2022-04-09 01:46:23 | 2022-04-09 01:46:23 | 0.35 | dict | {'P03971': {IcellnetAnnotation(role='ligand', family='Cytokine', subfamily=None, classification=('Cytokine', 'Tgf'))}, Complex: COMPLEX:P36894_Q16671: {IcellnetAnnotation(role='receptor', family='Cytokine', subfamily=None, classification=('Cytokine', 'Tgf'))}, 'P36894': {IcellnetAnnotation(role='rec...(truncated) | 688 | {} | 2022-04-09 01:46:23 | |
| ¶ | pypath.inputs.icellnet.icellnet_complexes | 2022-04-09 01:46:23 | 2022-04-09 01:46:23 | 0.13 | dict | {'COMPLEX:P36894_Q16671': Complex: COMPLEX:P36894_Q16671, 'COMPLEX:Q04771_Q16671': Complex: COMPLEX:Q04771_Q16671, 'COMPLEX:P27037_P37023': Complex: COMPLEX:P27037_P37023, 'COMPLEX:P37023_Q13705': Complex: COMPLEX:P37023_Q13705, 'COMPLEX:P37023_Q13873': Complex: COMPLEX:P37023_Q13873, 'COMPLEX:O0023...(truncated) | 117 | {} | 2022-04-09 01:46:23 | |
| ¶ | pypath.inputs.icellnet.icellnet_interactions | 2022-04-09 01:46:23 | 2022-04-09 01:46:23 | 0.13 | list | [IcellnetRecord(ligand='P03971', receptor=Complex: COMPLEX:P36894_Q16671, family='Cytokine', subfamily=None, classification=['Cytokine', 'Tgf'], resources=None, references=['32333774']), IcellnetRecord(ligand='P03971', receptor=Complex: COMPLEX:Q04771_Q16671, family='Cytokine', subfamily=None, class...(truncated) | 743 | {} | 2022-04-09 01:46:23 | |
| ¶ | pypath.inputs.ielm.get_ielm |
Not calling `pypath.inputs.ielm.get_ielm`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ielm.get_ielm_huge |
Not calling `pypath.inputs.ielm.get_ielm_huge`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.imweb._get_imweb | 2022-04-09 01:46:23 | 2022-04-09 01:46:30 | 6.61 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/imweb.py", line 76, in _get_imweb
hdrs.append('Cookie: access-token=%s' % json.loads(c0.result)['token'])
File "/usr/lib/python3.9/json/__init__.py", line 339, in loads
raise TypeError(f'the JSON object must be str, bytes or bytearray, '
TypeError: the JSON object must be str, bytes or bytearray, not NoneType
|
{} | 2022-01-08 00:05:26 | |||
| ¶ | pypath.inputs.imweb.get_imweb | 2022-04-09 01:46:30 | 2022-04-09 01:46:30 | 0.07 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/imweb.py", line 115, in get_imweb
token = json.loads(fp.read())['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-01-08 00:05:27 | |||
| ¶ | pypath.inputs.imweb.get_imweb_req | 2022-04-09 01:46:30 | 2022-04-09 01:46:35 | 5.53 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/imweb.py", line 142, in get_imweb_req
token = json.loads(r0.text)['token']
File "/usr/lib/python3.9/json/__init__.py", line 346, in loads
return _default_decoder.decode(s)
File "/usr/lib/python3.9/json/decoder.py", line 337, in decode
obj, end = self.raw_decode(s, idx=_w(s, 0).end())
File "/usr/lib/python3.9/json/decoder.py", line 355, in raw_decode
raise JSONDecodeError("Expecting value", s, err.value) from None
json.decoder.JSONDecodeError: Expecting value: line 1 column 1 (char 0)
|
{} | 2022-01-08 00:05:27 | |||
| ¶ | pypath.inputs.innatedb.innatedb_interactions | 2022-04-09 01:46:35 | 2022-04-09 01:46:43 | 7.85 | list | [InnatedbInteraction(source_uniprot='Q9Y6Y9', source_genesymbol='LY96', target_uniprot='O00206', target_genesymbol='TLR4', pmid='10359581'), InnatedbInteraction(source_uniprot='Q99836', source_genesymbol='MYD88', target_uniprot='O00206', target_genesymbol='TLR4', pmid='17228323'), InnatedbInteractio...(truncated) | 19,036 | {} | 2022-04-09 01:46:35 | |
| ¶ | pypath.inputs.instruct.get_instruct | 2022-04-09 01:46:43 | 2022-04-09 01:46:59 | 16.07 | list | [{'Q05513': {'pfam': 'PF00069', 'chain': None, 'seq': [['252', '518']]}, 'uniprots': ['Q05513', 'Q05513'], 'source': 'Instruct', 'pdb': ['3pfq'], 'references': ['11078718', '15665819', '17203073', '18650932', '19920073', '21900206', '21911421', '9748166']}, {'P01106': {'pfam': 'PF02344', 'chain': No...(truncated) | 11,470 | {} | 2022-04-09 01:46:43 | |
| ¶ | pypath.inputs.instruct.get_instruct_offsets | 2022-04-09 01:46:59 | 2022-04-09 01:47:00 | 1.02 | dict | {('10gs', 'P09211'): 0, ('11gs', 'P09211'): 0, ('12gs', 'P09211'): 0, ('13gs', 'P09211'): 0, ('14gs', 'P09211'): 0, ('16gs', 'P09211'): 0, ('17gs', 'P09211'): 0, ('18gs', 'P09211'): 0, ('19gs', 'P09211'): 0, ('1a00', 'P68871'): 0, ('1a00', 'P69905'): 0, ('1a01', 'P68871'): 0, ('1a01', 'P69905'): 0, ...(truncated) | 11,620 | {} | 2022-04-09 01:46:59 | |
| ¶ | pypath.inputs.intact._try_isoform |
Not calling `pypath.inputs.intact._try_isoform`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.intact.intact_interactions | 2022-04-09 01:47:00 | 2022-04-09 01:56:27 | 567.00 | list | [IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', id_type_b='uniprot', pubmeds={'10542231'}, methods={'peptide array'}, interaction_types={'direct interaction'}, mi_score=0.77, isoform_a=None, isoform_b=None), IntactInteraction(id_a='P49418', id_b='Q05193', id_type_a='uniprot', i...(truncated) | 70,962 | {} | 2022-04-09 01:47:00 | |
| ¶ | pypath.inputs.integrins.get_integrins | 2022-04-09 01:56:28 | 2022-04-09 01:56:29 | 1.18 | set | {'P08514', 'P16144', 'Q9UKX5', 'P38570', 'P26006', 'P05107', 'P08648', 'P56199', 'P05106', 'P05556', 'P53708', 'P23229', 'P06756', 'O75578', 'P18564', 'P20701', 'P17301', 'Q13349', 'P18084', 'P26012', 'P20702', 'Q13683', 'Q13797', 'P26010', 'P11215'} | 25 | {} | 2022-04-09 01:56:28 | |
| ¶ | pypath.inputs.intogen.intogen_annotations | 2022-04-09 01:56:29 | 2022-04-09 01:56:30 | 1.00 | dict | {'P00519': {IntogenAnnotation(type='FUSION', role='Activating', curated=False, oncodrive_role_prob=nan)}, 'P42684': {IntogenAnnotation(type='MUTATION', role='Activating', curated=False, oncodrive_role_prob=0.811)}, 'Q13085': {IntogenAnnotation(type='MUTATION', role='Activating', curated=False, oncod...(truncated) | 480 | {} | 2022-04-09 01:56:29 | |
| ¶ | pypath.inputs.ipi._ipi_uniprot_pairs |
Not calling `pypath.inputs.ipi._ipi_uniprot_pairs`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ipi.ipi_uniprot | 2022-04-09 01:56:30 | 2022-04-09 01:56:30 | 0.30 | dict | {'IPI00807623': {'A0A183'}, 'IPI00396341': {'A0AUZ9'}, 'IPI00884975': {'A0AUZ9'}, 'IPI00884987': {'A0AUZ9'}, 'IPI00885003': {'A0AUZ9'}, 'IPI00855723': {'A0AV02'}, 'IPI00867607': {'A0AV02'}, 'IPI00793608': {'A0AV02'}, 'IPI00867726': {'A0AV02'}, 'IPI00867740': {'A0AV02'}, 'IPI00169342': {'A0AV96'}, 'I...(truncated) | 51,106 | {} | 2022-04-09 01:56:30 | |
| ¶ | pypath.inputs.iptmnet.iptmnet_interactions | 2022-04-09 01:56:30 | 2022-04-09 02:00:08 | 218.02 | list | [IptmnetInteraction(enzyme='Q92793', substrate='O15265', enzyme_isoform=None, substrate_isoform=1, ptm_type='acetylation', resaa='257', resnum='K', score=None, references=['19955365']), IptmnetInteraction(enzyme='Q09472', substrate='O15527', enzyme_isoform=None, substrate_isoform=1, ptm_type='acetyl...(truncated) | 16,686 | {} | 2022-04-09 01:56:30 | |
| ¶ | pypath.inputs.italk.italk_annotations | 2022-04-09 02:00:08 | 2022-04-09 02:00:09 | 0.84 | dict | {'P01023': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'Q07954': {ItalkAnnotation(mainclass='receptor', subclass='other'), ItalkAnnotation(mainclass='receptor', subclass='growth factor')}, 'Q16613': {ItalkAnnotation(mainclass='ligand', subclass='other')}, 'P48039': {ItalkAnnotation(main...(truncated) | 1,414 | {} | 2022-04-09 02:00:08 | |
| ¶ | pypath.inputs.italk.italk_interactions | 2022-04-09 02:00:09 | 2022-04-09 02:00:09 | 0.29 | list | [ItalkInteraction(ligand='P01023', receptor='Q07954', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P48039', classification='other'), ItalkInteraction(ligand='Q16613', receptor='P49286', classification='other'), ItalkInteraction(ligand='P12821', receptor='P50052', classificati...(truncated) | 2,706 | {} | 2022-04-09 02:00:09 | |
| ¶ | pypath.inputs.italk.italk_raw | 2022-04-09 02:00:09 | 2022-04-09 02:00:09 | 0.01 | DataFrame | Pair.Name ... Classification 0 A2M_LRP1 ... other 1 AANAT_MTNR1A ... other 2 AANAT_MTNR1B ... other 3 ACE_AGTR2 ... other 4 ACE_BDKRB2 ... other ... ... ... ... 2644 CXCL8_KSHV ...(truncated) | 2,649 | {} | 2022-04-09 02:00:09 | |
| ¶ | pypath.inputs.kea.kea_enzyme_substrate | 2022-04-09 02:00:09 | 2022-04-09 02:00:15 | 5.96 | list | [{'start': None, 'end': None, 'instance': None, 'substrate': 'P08581', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 1349, 'references': {'15475459'}, 'typ': 'phosphorylation'}, {'start': None, 'end': None, 'instance': None, 'substrate': 'P98161', 'kinase': 'P00519', 'resaa': 'Y', 'resnum': 432, 'refe...(truncated) | 35,196 | {} | 2022-04-09 02:00:09 | |
| ¶ | pypath.inputs.kea.kea_interactions | 2022-04-09 02:00:15 | 2022-04-09 02:00:19 | 3.68 | list | [KeaRecord(enzyme='P00519', substrate='P08581', residue_type='Y', residue_offset=1349, pmid='15475459', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', residue_type='Y', residue_offset=432, pmid='12637538', resource='Kinexus'), KeaRecord(enzyme='P00519', substrate='P98161', resid...(truncated) | 35,196 | {} | 2022-04-09 02:00:15 | |
| ¶ | pypath.inputs.kegg.kegg_dbget |
Not calling `pypath.inputs.kegg.kegg_dbget`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.kegg.kegg_interactions | 2022-04-09 02:00:19 | 2022-04-09 02:02:22 | 122.74 | list | [KeggInteraction(id_a='Q03113', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcriptional=False), KeggInteraction(id_a='O94763', id_b='Q15283', effect='activation', pathway='MAPK signaling pathway', mechanism='', is_direct=True, transcription...(truncated) | 14,431 | {} | 2022-04-09 02:00:19 | |
| ¶ | pypath.inputs.kegg.kegg_medicus | 2022-04-09 02:02:22 | 2022-04-09 02:02:36 | 14.28 | set | {KeggMedicusRawInteraction(id_a='5330', id_b='C00076', name_a='PLCB2', name_b='Calcium cation', effect='stimulation', itype='post_translational', pw_type='variant', type_a='gene', type_b='metabolite', network_id='N00870'), KeggMedicusRawInteraction(id_a='2773', id_b='109', name_a='GNAI3', name_b='AD...(truncated) | 12,601 | {} | 2022-04-09 02:02:22 | |
| ¶ | pypath.inputs.kegg.kegg_medicus_complexes | 2022-04-09 02:02:36 | 2022-04-09 02:02:38 | 1.70 | dict | {'COMPLEX:O60762_O94777_Q9P2X0': Complex: COMPLEX:O60762_O94777_Q9P2X0, 'COMPLEX:O00231_O00232_O00233_O00487_O14818_O43242_P17980_P20618_P25786_P25787_P25788_P25789_P28066_P28070_P28072_P28074_P35998_P43686_P48556_P49720_P49721_P51665_P55036_P60896_P60900_P62191_P62195_P62333_Q13200_Q15008_Q16186_Q8...(truncated) | 266 | {} | 2022-04-09 02:02:36 | |
| ¶ | pypath.inputs.kegg.kegg_medicus_interactions | 2022-04-09 02:02:38 | 2022-04-09 02:02:40 | 1.95 | list | [KeggMedicusInteraction(id_a='P08754', id_b='O60266', entity_type_a='protein', entity_type_b='protein', interaction_type='post_translational', effect='inhibition'), KeggMedicusInteraction(id_a=Complex: COMPLEX:P25054_P49841_Q9Y2T1, id_b='P35222', entity_type_a='complex', entity_type_b='protein', int...(truncated) | 9,383 | {} | 2022-04-09 02:02:38 | |
| ¶ | pypath.inputs.kegg.kegg_pathway_annotations | 2022-04-09 02:02:40 | 2022-04-09 02:02:47 | 7.19 | dict | {'P10636': {KeggPathway(pathway='Parkinson disease'), KeggPathway(pathway='Pathways of neurodegeneration - multiple diseases'), KeggPathway(pathway='MAPK signaling pathway'), KeggPathway(pathway='Alzheimer disease')}, 'Q03113': {KeggPathway(pathway='MAPK signaling pathway'), KeggPathway(pathway='Pho...(truncated) | 2,574 | {} | 2022-04-09 02:02:40 | |
| ¶ | pypath.inputs.kegg.kegg_pathway_annotations_pathwaycommons | 2022-04-09 02:02:47 | 2022-04-09 02:02:47 | 0.47 | dict | {'A8K7J7': {KeggPathway(pathway='Metabolic pathways'), KeggPathway(pathway='Glycolysis / Gluconeogenesis'), KeggPathway(pathway='Galactose metabolism'), KeggPathway(pathway='Butirosin and neomycin biosynthesis'), KeggPathway(pathway='Amino sugar and nucleotide sugar metabolism'), KeggPathway(pathway...(truncated) | 813 | {} | 2022-04-09 02:02:47 | |
| ¶ | pypath.inputs.kegg.kegg_pathways | 2022-04-09 02:02:47 | 2022-04-09 02:02:55 | 7.54 | tuple | ({'MAPK signaling pathway': {'P10636', 'Q03113', 'P01583', 'Q5STR5', 'P35813', 'Q9Y2U5', 'Q9NRY4', 'P51617', 'O95382', 'P52564', 'Q06413', 'P0C869', 'P29965', 'P53041', 'P17980', 'Q96KG9', 'Q99836', 'P15056', 'Q12988', 'P45983', 'P21333', 'P29323', 'Q8IW41', 'P49407', 'P19838', 'Q9H2K8', 'O14733', '...(truncated) | 2 | {} | 2022-04-09 02:02:47 | |
| ¶ | pypath.inputs.kinasedotcom.kinasedotcom_annotations | 2022-04-09 02:02:55 | 2022-04-09 02:02:55 | 0.44 | dict | {'P31749': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'P31751': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'Q9Y243': {KinasedotcomAnnotation(group='AGC', family='Akt', subfamily=None)}, 'O14578': {KinasedotcomAnnotation(group='AGC', family='DMPK', ...(truncated) | 503 | {} | 2022-04-09 02:02:55 | |
| ¶ | pypath.inputs.kirouac2010.kirouac2010_interactions | 2022-04-09 02:02:55 | 2022-04-09 02:02:57 | 1.73 | list | [Kiruac2010Interaction(ligand='ADIPOQ', receptor='ADIPOR'), Kiruac2010Interaction(ligand='AGRP', receptor='ATRN'), Kiruac2010Interaction(ligand='AREG', receptor='EGFR'), Kiruac2010Interaction(ligand='ANGPTL1', receptor='TEK'), Kiruac2010Interaction(ligand='ANGPTL2', receptor='TEK'), Kiruac2010Intera...(truncated) | 267 | {} | 2022-04-09 02:02:55 | |
| ¶ | pypath.inputs.laudanna.laudanna_directions | 2022-04-09 02:02:57 | 2022-04-09 02:03:00 | 2.70 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/laudanna.py", line 56, in laudanna_directions
LaudannaDirection(
TypeError: <lambda>() missing 1 required positional argument: 'target_genesymbol'
|
{} | 2022-01-08 00:09:37 | |||
| ¶ | pypath.inputs.laudanna.laudanna_effects | 2022-04-09 02:03:00 | 2022-04-09 02:03:01 | 0.82 | list | [LaudannaEffect(source_genesymbol='EDNRA', target_genesymbol='NBN', effect='activation'), LaudannaEffect(source_genesymbol='TGFB1', target_genesymbol='TGFB1', effect='inhibition'), LaudannaEffect(source_genesymbol='EIF5B', target_genesymbol='RPL11', effect='activation'), LaudannaEffect(source_genesy...(truncated) | 63,438 | {} | 2022-04-09 02:03:00 | |
| ¶ | pypath.inputs.li2012.get_li2012 | 2022-04-09 02:03:01 | 2022-04-09 02:03:41 | 40.52 | list | [['BCR', 'BCR/177', 'ABL', 'PTPN SH2', 'CTK_Cytoplasm', 'ubiquitous', 'PPP'], ['BCR', 'BCR/177', 'ABL', 'GRB2 SH2', 'CTK_Cytoplasm', 'ubiquitous', 'PPP'], ['CAV', 'CAV1/14', 'ABL', 'GRB7 SH2', 'CTK_Membrane', 'ubiquitous', 'PPP'], ['CBL', 'CBL/700', 'ABL', 'CRK SH2', 'CTK_Cytoplasm', 'ubiquitous', '...(truncated) | 583 | {} | 2022-04-09 02:03:01 | |
| ¶ | pypath.inputs.li2012.li2012_dmi | 2022-04-09 02:03:41 | 2022-04-09 02:04:20 | 38.35 | list | [<ABL1 => Residue BCR-1:Y177:phosphorylation ['Li2012']>, <ABL1 => Residue BCR-1:Y177:phosphorylation ['Li2012']>, <ABL1 => Residue CAV1-1:Y14:phosphorylation ['Li2012']>, <ABL1 => Residue CBL-1:Y700:phosphorylation ['Li2012']>, <ABL1 => Residue CBL-1:Y700:phosphorylation ['Li2012']>, <ABL1 => Resid...(truncated) | 593 | {} | 2022-04-09 02:03:41 | |
| ¶ | pypath.inputs.li2012.li2012_enzyme_substrate | 2022-04-09 02:04:20 | 2022-04-09 02:04:20 | 0.03 | list | [{'substrate': 'BCR', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 177}, {'substrate': 'CAV1', 'kinase': 'ABL', 'instance': None, 'start': None, 'end': None, 'resaa': 'Y', 'resnum': 14}, {'substrate': 'CBL', 'kinase': 'ABL', 'instance': None, 'start': None, ...(truncated) | 349 | {} | 2022-04-09 02:04:20 | |
| ¶ | pypath.inputs.li2012.li2012_interactions | 2022-04-09 02:04:20 | 2022-04-09 02:04:20 | 0.03 | list | [['ABL', 'BCR', 'CTK_Cytoplasm', 'phosphorylation'], ['BCR', 'PTPN', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['BCR', 'GRB2', 'CTK_Cytoplasm', 'phosphomotif_binding'], ['ABL', 'CAV1', 'CTK_Membrane', 'phosphorylation'], ['CAV1', 'GRB7', 'CTK_Membrane', 'phosphomotif_binding'], ['ABL', 'CBL', 'CTK_C...(truncated) | 503 | {} | 2022-04-09 02:04:20 | |
| ¶ | pypath.inputs.lincs.lincs_compounds | 2022-04-09 02:04:20 | 2022-04-09 02:04:23 | 3.78 | dict | {'10001': LincsCompound(lincs='LSM-1001', chembl='CHEMBL14762', chebi='CHEBI:354.22', inchi='InChI=1S/C19H26N6O/c1-4-15(11-26)22-19-23-17(20-10-14-8-6-5-7-9-14)16-18(24-19)25(12-21-16)13(2)3/h5-9,12-13,15,26H,4,10-11H2,1-3H3,(H2,20,22,23,24)/t15-/m1/s1', inchi_key='BTIHMVBBUGXLCJ-OAHLLOKOSA-N', smil...(truncated) | 1,320 | {} | 2022-04-09 02:04:20 | |
| ¶ | pypath.inputs.lmpid.lmpid_dmi | 2022-04-09 02:04:23 | 2022-04-09 02:04:25 | 1.29 | list | [{'motif_protein': 'P54253', 'domain_protein': 'P62258', 'instance': 'RRWSAP', 'motif_start': 772, 'motif_end': 777, 'domain_name': '14-3-3 domain', 'domain_name_type': 'name', 'refs': ['20037628', '12757707']}, {'motif_protein': 'P54253', 'domain_protein': 'P63104', 'instance': 'RRWSAP', 'motif_sta...(truncated) | 1,170 | {} | 2022-04-09 02:04:23 | |
| ¶ | pypath.inputs.lmpid.lmpid_interactions | 2022-04-09 02:04:25 | 2022-04-09 02:04:25 | 0.63 | list | [['P62258', 'P54253', '20037628;12757707'], ['P63104', 'P54253', '20037628;12757707'], ['P63104', 'P04049', '8601312'], ['P27348', 'P04049', '8601312'], ['P31946', 'P04049', '8601312'], ['Q04917', 'P04049', '8601312'], ['P63104', 'Q99683', '10411906'], ['P63104', 'P98177', '14690436'], ['P62258', 'O...(truncated) | 1,170 | {} | 2022-04-09 02:04:25 | |
| ¶ | pypath.inputs.lmpid.load_lmpid | 2022-04-09 02:04:25 | 2022-04-09 02:04:26 | 0.89 | list | [{'bait': 'P54253', 'prey': 'P62258', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P54253', 'prey': 'P63104', 'refs': ['20037628', '12757707'], 'pos': [772, 777], 'inst': 'RRWSAP', 'dom': '14-3-3 domain'}, {'bait': 'P04049', 'prey': 'P6310...(truncated) | 1,170 | {} | 2022-04-09 02:04:25 | |
| ¶ | pypath.inputs.lncdisease.lncdisease_interactions | 2022-04-09 02:04:26 | 2022-04-09 02:04:27 | 0.28 | list | [LncdiseaseInteraction(source='7SK', target='ABO', source_type='RNA', target_type='RNA', mechanism='regulatory', organism='human', pmid='22522162'), LncdiseaseInteraction(source='7SK', target='Ars2', source_type='RNA', target_type='Protein', mechanism='regulatory', organism='human', pmid='22244333')...(truncated) | 478 | {} | 2022-04-09 02:04:26 | |
| ¶ | pypath.inputs.lncrnadb.lncrnadb_interactions | 2022-04-09 02:04:27 | 2022-04-09 02:04:27 | 0.61 | list | [LncrnadbInteraction(lncrna='Maternal somatic nucleus RNAs', partner='Scan RNAs', type='transcript', organism='Paramecium tetraurelia', pmid='19103667'), LncrnadbInteraction(lncrna='G22', partner='PABP', type='protein', organism='Loris tardigradus', pmid='17175535'), LncrnadbInteraction(lncrna='G22'...(truncated) | 773 | {} | 2022-04-09 02:04:27 | |
| ¶ | pypath.inputs.locate.locate_localizations | 2022-04-09 02:04:27 | 2022-04-09 02:06:07 | 99.81 | dict | {'P27824': {LocateAnnotation(source='HPRD', location='plasma membrane', cls='typeI', pmid=None, score=None), LocateAnnotation(source='HPRD', location='golgi apparatus', cls='typeI', pmid=None, score=None), LocateAnnotation(source='HPRD', location='lysosomes', cls='typeI', pmid=None, score=None), Loc...(truncated) | 9,496 | {} | 2022-04-09 02:04:27 | |
| ¶ | pypath.inputs.lrdb.lrdb_annotations | 2022-04-09 02:06:07 | 2022-04-09 02:06:08 | 0.90 | dict | {'P01023': {LrdbAnnotation(role='ligand', cell_type=None, sources=('Fantom5', 'HPMR', 'HPRD'), references=('10652313',))}, 'Q07954': {LrdbAnnotation(role='receptor', cell_type=None, sources=('Fantom5', 'HPRD'), references=('1281473', '7510694', '7989348')), LrdbAnnotation(role='receptor', cell_type=...(truncated) | 1,536 | {} | 2022-04-09 02:06:07 | |
| ¶ | pypath.inputs.lrdb.lrdb_interactions | 2022-04-09 02:06:08 | 2022-04-09 02:06:08 | 0.03 | list | [LrdbRecord(ligand_genesymbol='A2M', receptor_genesymbol='LRP1', sources=['Fantom5', 'HPMR', 'HPRD'], references=['10652313'], ligand_cells=[], receptor_cells=[]), LrdbRecord(ligand_genesymbol='AANAT', receptor_genesymbol='MTNR1A', sources=['Fantom5', 'HPMR'], references=['12943195'], ligand_cells=[...(truncated) | 3,251 | {} | 2022-04-09 02:06:08 | |
| ¶ | pypath.inputs.macrophage._trim_gname |
Not calling `pypath.inputs.macrophage._trim_gname`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.macrophage.macrophage_interactions | 2022-04-09 02:06:08 | 2022-04-09 02:06:09 | 0.60 | list | [MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16497931'), MacrophageInteraction(source_genesymbol='ATM', target_genesymbol='IKBKG', mechanism='Binding', directed='0', location='nucleus', pmid='16965765'), Macro...(truncated) | 4,516 | {} | 2022-04-09 02:06:08 | |
| ¶ | pypath.inputs.matrisome.__matrisome_annotations_2 | 2022-04-09 02:06:09 | 2022-04-09 02:06:25 | 16.76 | set | {'SEMA4D', 'PLAU', 'LAMC3', 'PLXNA1', 'LGI1', 'SFTPD', 'C1QL4', 'Itih2', 'Col1a1', 'Matn1', 'Lepre1', 'Serping1', 'TGFBI', 'Fbln2', 'Col12a1', 'Hcfc1', 'COLEC12', 'RELN', 'IMPG1', 'Emilin1', 'Plg', 'Kng1', 'LOXL1', 'NPNT', 'Anxa7', 'LAMA1', 'WNT7A', 'NID2', 'MMP23B', 'Ltbp2', 'Lama2', 'ADAM17', 'VWC...(truncated) | 744 | {} | 2022-04-09 02:06:09 | |
| ¶ | pypath.inputs.matrisome.matrisome_annotations | 2022-04-09 02:06:25 | 2022-04-09 02:06:26 | 0.91 | dict | {'B4DSV9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'Q7Z7G0': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycoproteins', subsubclass=None)}, 'Q5JPC9': {MatrisomeAnnotation(mainclass='Core matrisome', subclass='ECM Glycopro...(truncated) | 1,064 | {} | 2022-04-09 02:06:25 | |
| ¶ | pypath.inputs.matrixdb._matrixdb_protein_list |
Not calling `pypath.inputs.matrixdb._matrixdb_protein_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.matrixdb.matrixdb_annotations | 2022-04-09 02:06:26 | 2022-04-09 02:06:32 | 6.21 | dict | {'O43808': {MatrixdbAnnotation(mainclass='membrane')}, 'Q96PS8': {MatrixdbAnnotation(mainclass='membrane')}, 'Q8IUA7': {MatrixdbAnnotation(mainclass='membrane')}, 'A0A577': {MatrixdbAnnotation(mainclass='membrane')}, 'A0A0B4J263': {MatrixdbAnnotation(mainclass='membrane')}, 'Q8NFZ8': {MatrixdbAnnota...(truncated) | 10,097 | {} | 2022-04-09 02:06:26 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_ecm_proteins | 2022-04-09 02:06:32 | 2022-04-09 02:06:33 | 0.09 | set | {'P78539', 'Q8NC24', 'Q9Y5L3', 'Q13361', 'O15072', 'Q96DN2', 'Q502W6', 'Q7Z5L7', 'Q6UX34', 'Q99727', 'Q9H8L6', 'P10745', 'Q5JSJ4', 'Q96GW7', 'Q6W4X9', 'Q9HB63', 'Q6PJE2', 'Q9NS15', 'Q9UQP3', 'Q6ZRI0', 'P05230', 'P53420', 'Q86XX4', 'Q96S86', 'Q13201', 'P80108', 'P25940', 'Q8N0V4', 'Q4ZHG4', 'Q96A84',...(truncated) | 483 | {} | 2022-04-09 02:06:32 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_interactions | 2022-04-09 02:06:33 | 2022-04-09 02:06:33 | 0.19 | list | [['P13497', 'Q15113', '20979576', 'protease assay'], ['O00206', 'P21810', '24480070', 'microscale thermophoresis'], ['P49747', 'O15232', '22521401', 'enzyme linked immunosorbent assay'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O60568', 'O60568', '20955792', 'molecular sieving'], ['O...(truncated) | 425 | {} | 2022-04-09 02:06:33 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_membrane_proteins | 2022-04-09 02:06:33 | 2022-04-09 02:06:38 | 4.88 | set | {'O43808', 'Q96PS8', 'Q8IUA7', 'A0A577', 'A0A0B4J263', 'Q8NFZ8', 'Q02878', 'P43686', 'P55209', 'Q9Y2U8', 'Q05513', 'A0A0C4DH25', 'Q8NCQ3', 'Q8N816', 'Q05084', 'Q9UBV2', 'A8MWX3', 'P0DOX2', 'Q9NQC7', 'Q9NXG6', 'Q9H3V2', 'Q969X1', 'P01860', 'Q13884', 'Q86TG1', 'P62333', 'Q92614', 'Q15546', 'Q96H96', '...(truncated) | 8,240 | {} | 2022-04-09 02:06:33 | |
| ¶ | pypath.inputs.matrixdb.matrixdb_secreted_proteins | 2022-04-09 02:06:38 | 2022-04-09 02:06:38 | 0.48 | set | {'P49863', 'Q9HD89', 'Q9UBI1', 'Q8TAA1', 'Q6UDR6', 'O43508', 'P03973', 'Q86SG7', 'Q14641', 'Q07325', 'O15072', 'Q6IE38', 'P09871', 'Q04725', 'A0A0C4DH42', 'Q86Y38', 'Q6UX34', 'Q8N729', 'A0A0C4DH25', 'P0C869', 'Q16674', 'P17980', 'P07911', 'Q96PF1', 'P68402', 'O75493', 'Q14508', 'P0DOX2', 'O14793', '...(truncated) | 2,923 | {} | 2022-04-09 02:06:38 | |
| ¶ | pypath.inputs.mcam.mcam_cell_adhesion_molecules | 2022-04-09 02:06:38 | 2022-04-09 02:06:39 | 0.88 | set | {'Q8IUX7', 'Q9Y624', 'Q9Y5Y7', 'P28906', 'P78325', 'P13612', 'Q86WK7', 'Q13895', 'P11215', 'P13591', 'P16144', 'Q05084', 'Q9UKX5', 'P18827', 'P56748', 'P16150', 'Q8WWQ8', 'P42081', 'P56746', 'Q92896', 'Q12816', 'P25940', 'P07359', 'Q96GP6', 'Q86WK6', 'Q13477', 'O15394', 'P08575', 'Q96KR4', 'Q9BYD3',...(truncated) | 103 | {} | 2022-04-09 02:06:38 | |
| ¶ | pypath.inputs.membranome.membranome_annotations | 2022-04-09 02:06:39 | 2022-04-09 02:08:55 | 136.43 | list | [('P08575', 'Plasma membrane', 'extracellular side'), ('P23468', 'Plasma membrane', 'extracellular side'), ('P10586', 'Plasma membrane', 'extracellular side'), ('P23470', 'Plasma membrane', 'extracellular side'), ('Q13332', 'Plasma membrane', 'extracellular side'), ('P23471', 'Plasma membrane', 'ext...(truncated) | 2,386 | {} | 2022-04-09 02:06:39 | |
| ¶ | pypath.inputs.mimp.get_kinase_class | 2022-04-09 02:08:55 | 2022-04-09 02:08:56 | 0.17 | dict | {'groups': {'AGC': ['AKT1', 'AKT2', 'AKT3', 'DMPK1', 'DMPK2', 'MRCKb', 'MRCKa', 'MRCK', 'ROCK2', 'ROCK1', 'CRIK', 'BARK1', 'BARK2', 'GPRK4', 'GPRK5', 'GPRK6', 'RHOK', 'GPRK6', 'GPRK7', 'MAST3', 'MAST2', 'MAST1', 'MASTL', 'MAST4', 'NDR1', 'LATS1', 'LATS2', 'NDR2', 'PKACa', 'PKACb', 'PKACg', 'PRKX', '...(truncated) | 4 | {} | 2022-04-09 02:08:55 | |
| ¶ | pypath.inputs.mimp.mimp_enzyme_substrate | 2022-04-09 02:08:56 | 2022-04-09 02:09:16 | 20.15 | list | [{'instance': 'VVGARRSSWRVISSI', 'kinase': 'PDKC', 'resaa': 'S', 'resnum': 60, 'npmid': 8, 'substrate_refseq': 'NM_003404', 'substrate': 'YWHAB', 'start': 53, 'end': 67, 'databases': ['HPRD', 'phosphoELM', 'PhosphoSite']}, {'instance': 'VVGARRSSWRVISSI', 'kinase': 'PRKCD', 'resaa': 'S', 'resnum': 60...(truncated) | 17,030 | {} | 2022-04-09 02:08:56 | |
| ¶ | pypath.inputs.mimp.mimp_interactions | 2022-04-09 02:09:16 | 2022-04-09 02:09:16 | 0.38 | list | [['PDKC', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCD', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PRKCZ', 'YWHAB', ['HPRD', 'phosphoELM', 'PhosphoSite']], ['PDKC', 'YWHAH', ['phosphoELM', 'PhosphoSite']], ['ATM', 'EIF4EBP1', ['phosphoELM', 'PhosphoSite']], ['RORC', 'EIF4EBP1', ...(truncated) | 17,030 | {} | 2022-04-09 02:09:16 | |
| ¶ | pypath.inputs.mir2disease.mir2disease_interactions | 2022-04-09 02:09:16 | 2022-04-09 02:09:16 | 0.23 | list | [Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='KRAS', year='2008', sentence="A SNP in a let-7 microRNA complementary site in the KRAS 3' untranslated region increases non-small cell lung cancer risk."), Mir2diseaseInteraction(mirna='hsa-let-7a', target_genesymbol='HMGA2', year='2008'...(truncated) | 805 | {} | 2022-04-09 02:09:16 | |
| ¶ | pypath.inputs.mirbase.get_mirbase_aliases | 2022-04-09 02:09:16 | 2022-04-09 02:09:16 | 0.08 | tuple | ({'MIMAT0000062': {'hsa-let-7a', 'hsa-let-7a-5p'}, 'MIMAT0000063': {'hsa-let-7b-5p', 'hsa-let-7b'}, 'MIMAT0000064': {'hsa-let-7c-5p', 'hsa-let-7c'}, 'MIMAT0000065': {'hsa-let-7d-5p', 'hsa-let-7d'}, 'MIMAT0000066': {'hsa-let-7e', 'hsa-let-7e-5p'}, 'MIMAT0000067': {'hsa-let-7f', 'hsa-let-7f-5p'}, 'MIM...(truncated) | 2 | {} | 2022-04-09 02:09:16 | |
| ¶ | pypath.inputs.mirbase.mirbase_ids | 2022-04-09 02:09:16 | 2022-04-09 02:09:17 | 0.08 | list | [('MIMAT0000062', 'MI0000062'), ('MIMAT0000062', 'MI0000061'), ('MIMAT0000062', 'MI0000060'), ('MIMAT0000063', 'MI0000063'), ('MIMAT0000064', 'MI0000064'), ('MIMAT0000065', 'MI0000065'), ('MIMAT0000066', 'MI0000066'), ('MIMAT0000067', 'MI0000067'), ('MIMAT0000067', 'MI0000068'), ('MIMAT0000068', 'MI...(truncated) | 3,027 | {} | 2022-04-09 02:09:16 | |
| ¶ | pypath.inputs.mirbase.mirbase_mature | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.06 | list | [('MIMAT0000062', 'hsa-let-7a'), ('MIMAT0000062', 'hsa-let-7a-5p'), ('MIMAT0000063', 'hsa-let-7b-5p'), ('MIMAT0000063', 'hsa-let-7b'), ('MIMAT0000064', 'hsa-let-7c-5p'), ('MIMAT0000064', 'hsa-let-7c'), ('MIMAT0000065', 'hsa-let-7d-5p'), ('MIMAT0000065', 'hsa-let-7d'), ('MIMAT0000066', 'hsa-let-7e'),...(truncated) | 3,487 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirbase.mirbase_mature_all | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.08 | list | ['MIMAT0000062', 'MIMAT0000062', 'MIMAT0000062', 'MIMAT0000063', 'MIMAT0000064', 'MIMAT0000065', 'MIMAT0000066', 'MIMAT0000067', 'MIMAT0000067', 'MIMAT0000068', 'MIMAT0000069', 'MIMAT0000069', 'MIMAT0000070', 'MIMAT0000071', 'MIMAT0000072', 'MIMAT0000073', 'MIMAT0000074', 'MIMAT0000074', 'MIMAT00000...(truncated) | 3,027 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.06 | list | [('MI0000060', 'hsa-let-7a-1'), ('MI0000060', 'hsa-let-7a-1L'), ('MI0000061', 'hsa-let-7a-2'), ('MI0000061', 'hsa-let-7a-2L'), ('MI0000062', 'hsa-let-7a-3'), ('MI0000062', 'hsa-let-7a-3L'), ('MI0000063', 'hsa-let-7bL'), ('MI0000063', 'hsa-let-7b'), ('MI0000064', 'hsa-let-7cL'), ('MI0000064', 'hsa-le...(truncated) | 2,173 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor_all | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.08 | list | ['MI0000062', 'MI0000061', 'MI0000060', 'MI0000063', 'MI0000064', 'MI0000065', 'MI0000066', 'MI0000067', 'MI0000068', 'MI0000069', 'MI0000070', 'MI0000115', 'MI0000071', 'MI0000071', 'MI0000072', 'MI0000073', 'MI0000074', 'MI0000075', 'MI0000076', 'MI0000077', 'MI0000078', 'MI0000079', 'MI0000080', ...(truncated) | 3,027 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirbase.mirbase_precursor_to_mature | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.15 | list | [('hsa-let-7a-1', 'MIMAT0000062'), ('hsa-let-7a-1', 'MIMAT0004481'), ('hsa-let-7a-1L', 'MIMAT0000062'), ('hsa-let-7a-1L', 'MIMAT0004481'), ('hsa-let-7a-2', 'MIMAT0000062'), ('hsa-let-7a-2', 'MIMAT0010195'), ('hsa-let-7a-2', 'MIMAT0004481'), ('hsa-let-7a-2L', 'MIMAT0000062'), ('hsa-let-7a-2L', 'MIMAT...(truncated) | 3,361 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirdeathdb.mirdeathdb_interactions | 2022-04-09 02:09:17 | 2022-04-09 02:09:17 | 0.25 | list | [MirdeathdbInteraction(mirna='MIMAT0020823', target_entrez='40009', organism=7227, pubmed='12679032', function='apoptosis_down'), MirdeathdbInteraction(mirna='MIMAT0000365', target_entrez='40009', organism=7227, pubmed='12679032', function='apoptosis_down'), MirdeathdbInteraction(mirna='MIMAT0020823...(truncated) | 462 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirecords.mirecords_interactions | 2022-04-09 02:09:17 | 2022-04-09 02:09:22 | 5.12 | list | [MirecordsInteraction(mirna_name='hsa-miR-23a', target_refseq='NM_198155', target_genesymbol='C21orf33', mirna_organism='Homo sapiens', target_organism='Homo sapiens', pmid='12808467'), MirecordsInteraction(mirna_name='mmu-miR-434-3p', target_refseq='NM_184109', target_genesymbol='Rtl1', mirna_organ...(truncated) | 3,106 | {} | 2022-04-09 02:09:17 | |
| ¶ | pypath.inputs.mirtarbase._mirtarbase_interactions |
Not calling `pypath.inputs.mirtarbase._mirtarbase_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mirtarbase.mirtarbase_interactions | 2022-04-09 02:09:22 | 2022-04-09 02:10:00 | 37.42 | list | [MirtarbaseInteraction(mirtarbase_id='MIRT003135', mirna_name='mmu-miR-122-5p', mirna_organism='Mus musculus', target_genesymbol='Cd320', target_entrez='54219', target_organism='Mus musculus', target_site='AGAGACTGGGGTCCTCAGACACTCCC', method='Luciferase reporter assay//qRT-PCR//Western blot', catego...(truncated) | 21,560 | {} | 2022-04-09 02:09:22 | |
| ¶ | pypath.inputs.mitab.mitab_field_list |
Not calling `pypath.inputs.mitab.mitab_field_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mitab.mitab_field_uniprot |
Not calling `pypath.inputs.mitab.mitab_field_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.mppi.mppi_interactions | 2022-04-09 02:10:00 | 2022-04-09 02:10:00 | 0.38 | list | [['9867828', '9867828', 'P05109', 'SP', 'S100A8;CAGA;MRP8; calgranulin A (migration inhibitory factor-related protein 8)', '9606', 'P06702', 'SP', 'S100A9;CAGB;MRP14; calgranulin B (migration inhibitory factor-related protein 14)', '9606'], ['9867828', '9867828', 'P06702', 'SP', 'S100A9;CAGB;MRP14; ...(truncated) | 777 | {} | 2022-04-09 02:10:00 | |
| ¶ | pypath.inputs.msigdb.msigdb_annotations | 2022-04-09 02:10:00 | 2022-04-09 02:13:15 | 194.56 | dict | {'P04141': {MsigdbAnnotation(collection='wikipathways', geneset='WP_OVERVIEW_OF_PROINFLAMMATORY_AND_PROFIBROTIC_MEDIATORS'), MsigdbAnnotation(collection='cell_type_signatures', geneset='GAUTAM_EYE_CHOROID_SCLERA_ACTIVATED_T_CELLS'), MsigdbAnnotation(collection='kegg_pathways', geneset='KEGG_JAK_STAT...(truncated) | 20,065 | {} | 2022-04-09 02:10:00 | |
| ¶ | pypath.inputs.msigdb.msigdb_download | 2022-04-09 02:13:16 | 2022-04-09 02:13:55 | 38.79 | dict | {'chr1p11': {'RNVU1-4', 'LINC00623', 'FCGR1B', 'NBPF26', 'H3P4', 'PFN1P2', 'RPL22P6', 'RNVU1-19', 'MTIF2P1', 'NOTCH2NLR', 'SRGAP2-AS1', 'EMBP1', 'PDE4DIPP4', 'NBPF8', 'PDE4DIPP2', 'LINC01691', 'H2BP1', 'FAM72B', 'SRGAP2C', 'LINC02798', 'PPIAL4A'}, 'chr1p12': {'GAPDHP58', 'ENSG00000226172', 'TBX15', ...(truncated) | 32,880 | {} | 2022-04-09 02:13:16 | |
| ¶ | pypath.inputs.msigdb.msigdb_download_collections | 2022-04-09 02:13:56 | 2022-04-09 02:13:56 | 0.46 | dict | {('hallmark', 'h.all'): {'HALLMARK_TNFA_SIGNALING_VIA_NFKB': {'PLAU', 'TNFAIP3', 'PDE4B', 'MCL1', 'PDLIM5', 'NFKB1', 'FUT4', 'STAT5A', 'KLF6', 'RELB', 'ZC3H12A', 'LIF', 'TRIB1', 'SQSTM1', 'GFPT2', 'TGIF1', 'IER3', 'CD80', 'IRF1', 'CLCF1', 'SERPINB8', 'PLAUR', 'CCNL1', 'ATF3', 'SAT1', 'TIPARP', 'IL23...(truncated) | 18 | {} | 2022-04-09 02:13:56 | |
| ¶ | pypath.inputs.ncrdeathdb.ncrdeathdb_interactions | 2022-04-09 02:13:56 | 2022-04-09 02:13:59 | 2.32 | list | [NcrdeathdbInteraction(ncrna='MIMAT0000062', target_gene='ain-1', ncrna_type='miRNA', pathway='autophagy', effect='down', pmid='23619095', organism=6239), NcrdeathdbInteraction(ncrna='MIMAT0000063', target_gene='ain-1', ncrna_type='miRNA', pathway='autophagy', effect='down', pmid='23619095', organis...(truncated) | 7,305 | {} | 2022-04-09 02:13:56 | |
| ¶ | pypath.inputs.negatome.negatome_interactions | 2022-04-09 02:13:59 | 2022-04-09 02:13:59 | 0.12 | list | [NegatomeInteraction(uniprot_a='Q6ZNK6', uniprot_b='Q9Y4K3', pmid='15047173', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='Q9NR31', uniprot_b='Q15797', pmid='17356069', method='coimmunoprecipitation'), NegatomeInteraction(uniprot_a='P11627', uniprot_b='P53986', pmid='20155396', me...(truncated) | 2,171 | {} | 2022-04-09 02:13:59 | |
| ¶ | pypath.inputs.netbiol._netbiol_interactions |
Not calling `pypath.inputs.netbiol._netbiol_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.netbiol.arn_interactions | 2022-04-09 02:13:59 | 2022-04-09 02:13:59 | 0.14 | list | [ArnInteraction(source_uniprot='O15350', target_uniprot='O95352', is_direct='0', is_directed='1', effect='0', source_autophagy='0', target_autophagy='1', references='19001857'), ArnInteraction(source_uniprot='O15350', target_uniprot='Q9H1Y0', is_direct='0', is_directed='1', effect='0', source_autoph...(truncated) | 95 | {} | 2022-04-09 02:13:59 | |
| ¶ | pypath.inputs.netbiol.nrf2ome_interactions | 2022-04-09 02:13:59 | 2022-04-09 02:13:59 | 0.14 | list | [Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='O15379', is_direct='1', is_directed='0', effect='0', references='18241676'), Nrf2omeInteraction(source_uniprot='O00221', target_uniprot='Q16236', is_direct='0', is_directed='1', effect='-1', references='18241676'), Nrf2omeInteraction(sourc...(truncated) | 109 | {} | 2022-04-09 02:13:59 | |
| ¶ | pypath.inputs.netpath.netpath_interactions | 2022-04-09 02:13:59 | 2022-04-09 02:14:02 | 2.28 | list | [['IL4R', '3566', 'IL4R', '3566', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL4R', '3566', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleukin-4 (IL-4)'], ['IL2RG', '3561', 'IL2RG', '3561', '8266078', 'in vivo', 'physical interaction', 'Interleu...(truncated) | 7,555 | {} | 2022-04-09 02:13:59 | |
| ¶ | pypath.inputs.netpath.netpath_names | 2022-04-09 02:14:02 | 2022-04-09 02:14:02 | 0.01 | dict | {'137': 'Advanced glycation end-products (AGE/RAGE)', '1': 'Alpha6 Beta4 Integrin', '2': 'Androgen receptor (AR)', '12': 'B cell receptor (BCR)', '76': 'Brain-derived neurotrophic factor (BDNF)', '129': 'Corticotropin-releasing hormone (CRH)', '4': 'Epidermal growth factor receptor (EGFR)', '25': 'F...(truncated) | 35 | {} | 2022-04-09 02:14:02 | |
| ¶ | pypath.inputs.netpath.netpath_pathway_annotations | 2022-04-09 02:14:02 | 2022-04-09 02:14:26 | 24.64 | dict | {'Q15109': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'O95831': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P54819': {NetpathPathway(pathway='Advanced glycation end-products (AGE/RAGE)')}, 'P31749': {NetpathPathway(pathway='Androgen receptor ...(truncated) | 1,869 | {} | 2022-04-09 02:14:02 | |
| ¶ | pypath.inputs.ontology.listof_ontologies | 2022-04-09 02:14:26 | 2022-04-09 02:14:27 | 1.24 | dict | {'aeo': 'Anatomical Entity Ontology', 'afo': 'Allotrope Merged Ontology Suite', 'agro': 'Agronomy Ontology', 'amphx': 'Amphioxus Development and Anatomy Ontology (AMPHX)', 'apo': 'Ascomycete Phenotype Ontology (APO)', 'apollo_sv': 'Apollo Structured Vocabulary (Apollo-SV)', 'aro': 'Antibiotic Resist...(truncated) | 273 | {} | 2022-04-09 02:14:26 | |
| ¶ | pypath.inputs.ontology.ontology |
Not calling `pypath.inputs.ontology.ontology`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.opm.opm_annotations | 2022-04-09 02:14:27 | 2022-04-09 02:14:40 | 12.12 | dict | {'O14745': {OpmAnnotation(membrane='Eykaryo. plasma', family='FXYD regulators', transmembrane=True)}, 'P08842': {OpmAnnotation(membrane='Endoplasm. reticulum', family='Sulfatase', transmembrane=True)}, 'P59666': {OpmAnnotation(membrane='Secreted', family='Vertebrate defensin', transmembrane=False)},...(truncated) | 404 | {} | 2022-04-09 02:14:27 | |
| ¶ | pypath.inputs.oreganno.oreganno_interactions | 2022-04-09 02:14:40 | 2022-04-09 03:14:40 | 3,600.12 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/oreganno.py", line 76, in oreganno_interactions
for l in oreganno_raw():
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/oreganno.py", line 43, in oreganno_raw
_ = next(data)
TypeError: 'NoneType' object is not an iterator
|
{} | 2022-04-01 01:18:20 | |||
| ¶ | pypath.inputs.oreganno.oreganno_raw | 2022-04-09 03:14:40 | 2022-04-09 04:14:40 | 3,600.08 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/oreganno.py", line 43, in oreganno_raw
_ = next(data)
TypeError: 'NoneType' object is not an iterator
|
{} | 2022-04-01 01:20:19 | |||
| ¶ | pypath.inputs.panglaodb.panglaodb_annotations | 2022-04-09 04:14:40 | 2022-04-09 04:14:42 | 2.25 | defaultdict | defaultdict(<class 'set'>, {'P17538': {PanglaodbAnnotation(canonical_marker=True, cell_type='Acinar cells', organ='Pancreas', germ_layer='Endoderm', entity_type='protein', human=(True,), mouse=(True,), human_sensitivity=1.0, mouse_sensitivity=0.957143, human_specificity=0.000628931, mouse_specificit...(truncated) | 4,807 | {} | 2022-04-09 04:14:40 | |
| ¶ | pypath.inputs.panglaodb.panglaodb_raw | 2022-04-09 04:14:42 | 2022-04-09 04:14:42 | 0.04 | list | [{'species': 'Mm Hs', 'official gene symbol': 'CTRB1', 'cell type': 'Acinar cells', 'nicknames': 'CTRB', 'ubiquitousness index': '0.017', 'product description': 'chymotrypsinogen B1', 'gene type': 'protein-coding gene', 'canonical marker': '1', 'germ layer': 'Endoderm', 'organ': 'Pancreas', 'sensiti...(truncated) | 8,286 | {} | 2022-04-09 04:14:42 | |
| ¶ | pypath.inputs.pathwaycommons._create_single_resource_method |
Not calling `pypath.inputs.pathwaycommons._create_single_resource_method`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons.pathwaycommons_interactions | 2022-04-09 04:14:42 | 2022-04-09 04:15:08 | 26.30 | list | [PathwayCommonsInteraction(id_a='A2M', interaction_type='interacts-with', id_b='APP', resource='DIP'), PathwayCommonsInteraction(id_a='ABCA1', interaction_type='interacts-with', id_b='CANX', resource='DIP'), PathwayCommonsInteraction(id_a='ABCA1', interaction_type='interacts-with', id_b='DMD', resou...(truncated) | 1,261,865 | {} | 2022-04-09 04:14:42 | |
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pathwaycommons._pc_single_resource |
Not calling `pypath.inputs.pathwaycommons._pc_single_resource`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pazar.pazar_interactions | 2022-04-09 04:15:09 | 2022-04-09 04:15:10 | 0.29 | list | [PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='9571041'), PazarInteraction(tf='ENST00000265354', target='ENSG00000143632', pmid='12760745'), PazarInteraction(tf='ENST00000265354', target='ENSG...(truncated) | 16,386 | {} | 2022-04-09 04:15:09 | |
| ¶ | pypath.inputs.pdb.pdb_chains | 2022-04-09 04:15:10 | 2022-04-09 04:15:15 | 5.69 | tuple | ({'P02185': [{'pdb': '101m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset': 1}, {'pdb': '102m', 'chain': 'A', 'chain_beg': 1, 'chain_end': 154, 'pdb_beg': 0, 'pdb_end': 153, 'uniprot_beg': 1, 'uniprot_end': 154, 'offset':...(truncated) | 2 | {} | 2022-04-09 04:15:10 | |
| ¶ | pypath.inputs.pdb.pdb_complexes | 2022-04-09 04:15:18 | 2022-04-09 04:15:25 | 6.96 | dict | {'COMPLEX:P00720': Complex: COMPLEX:P00720, 'COMPLEX:P09211': Complex: COMPLEX:P09211, 'COMPLEX:P00817': Complex: COMPLEX:P00817, 'COMPLEX:P00963': Complex: COMPLEX:P00963, 'COMPLEX:P00669': Complex: COMPLEX:P00669, 'COMPLEX:P07378': Complex: COMPLEX:P07378, 'COMPLEX:P01837_P01869': Complex: COMPLEX...(truncated) | 39,706 | {'size': 44} | 2022-04-09 04:15:18 | |
| ¶ | pypath.inputs.pdb.pdb_uniprot | 2022-04-09 04:15:25 | 2022-04-09 04:15:39 | 14.14 | tuple | ({'P02185': {('1ufp', 'X-ray', 2.1), ('1ch1', 'X-ray', 1.9), ('6d45', 'X-ray', 1.78), ('2mbw', 'X-ray', 1.5), ('1mlm', 'X-ray', 1.8), ('2zsr', 'X-ray', 1.21), ('5vzp', 'X-ray', 1.78), ('1do7', 'X-ray', 1.85), ('2w6w', 'X-ray', 1.99), ('3mn0', 'X-ray', 1.65), ('1a6k', 'X-ray', 1.1), ('4fwx', 'X-ray',...(truncated) | 2 | {} | 2022-04-09 04:15:25 | |
| ¶ | pypath.inputs.pdzbase.pdzbase_interactions | 2022-04-09 04:15:39 | 2022-04-09 04:15:40 | 1.07 | list | [PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P13569', isoform_ligand=1, genesymbol_pdz='NHERF-1', genesymbol_ligand='CFTR', pdz_domain=1, organism=9606, pubmed=9613608), PDZbaseInteraction(uniprot_pdz='O14745', isoform_pdz=1, uniprot_ligand='P40879', isoform_ligand=1, gen...(truncated) | 339 | {} | 2022-04-09 04:15:39 | |
| ¶ | pypath.inputs.pepcyber.pepcyber_details |
Not calling `pypath.inputs.pepcyber.pepcyber_details`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pepcyber.pepcyber_interactions | 2022-04-09 04:15:40 | 2022-04-09 04:28:48 | 787.43 | list | [PepcyberInteraction(ppdb_class='14-3-3', ppdb_genesymbol='LOC284100', substrate_genesymbol='Bad', binding_seq='SPFRGRSRpSAPPNLWAA', binding_pos=136, all_evidences='Inference', n_records=1, category='A', substrate_residue='S', ppdb_uniprot='A2RUB5', ppdb_refseq='XP_375443', substrate_uniprot='Q61337...(truncated) | 5,590 | {} | 2022-04-09 04:15:40 | |
| ¶ | pypath.inputs.pfam._pfam_uniprot |
Not calling `pypath.inputs.pfam._pfam_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pfam.pfam_names | 2022-04-09 04:28:48 | 2022-04-09 04:28:49 | 0.92 | tuple | ({'PFAM_NAME': {'PFAM_ACCESSION'}, 'Globin': {'PF00042'}, 'Phage_lysozyme': {'PF00959'}, 'GST_N': {'PF02798'}, 'GST_C_3': {'PF14497'}, 'DNA_methylase': {'PF00145'}, 'Pyrophosphatase': {'PF00719'}, 'AsnA': {'PF03590'}, 'RnaseA': {'PF00074'}, 'Ras': {'PF00071'}, 'Carb_anhydrase': {'PF00194'}, 'Lys': {...(truncated) | 2 | {} | 2022-04-09 04:28:48 | |
| ¶ | pypath.inputs.pfam.pfam_pdb | 2022-04-09 04:28:49 | 2022-04-09 04:28:51 | 2.74 | tuple | ({'101m': {'PF00042': PfamDomain(chain='A', start=27, end=143)}, '102l': {'PF00959': PfamDomain(chain='A', start=24, end=149)}, '102m': {'PF00042': PfamDomain(chain='A', start=27, end=143)}, '103l': {'PF00959': PfamDomain(chain='A', start=24, end=151)}, '103m': {'PF00042': PfamDomain(chain='A', star...(truncated) | 2 | {} | 2022-04-09 04:28:49 | |
| ¶ | pypath.inputs.pfam.pfam_regions | 2022-04-09 04:28:52 | 2022-04-09 04:49:36 | 1,243.88 | tuple | ({}, {}) | 2 | {} | 2022-04-09 04:28:52 | |
| ¶ | pypath.inputs.pfam.pfam_uniprot | 2022-04-09 04:49:36 | 2022-04-09 04:54:25 | 289.65 | tuple | ({'O60885': {'PF00439', 'PF17035', 'PF17105'}, 'Q9H720': set(), 'Q96FC7': {'PF00041', 'PF19281'}, 'Q9BUL8': set(), 'Q16342': {'PF04194', 'PF01753'}, 'A5PLL7': {'PF10520'}, 'Q13425': {'PF18012', 'PF00595'}, 'Q9Y216': {'PF06602'}, 'Q99457': {'PF00956'}, 'Q8NGY3': {'PF13853'}, 'Q9NS23': {'PF16517', 'PF...(truncated) | 2 | {} | 2022-04-09 04:49:36 | |
| ¶ | pypath.inputs.phobius.phobius_annotations | 2022-04-09 04:54:25 | 2022-04-09 04:54:26 | 0.93 | dict | {'P01920': {PhobiusAnnotation(tm_helices=1, signal_peptide=True, cytoplasmic=1, non_cytoplasmic=1)}, 'P18440': {PhobiusAnnotation(tm_helices=0, signal_peptide=False, cytoplasmic=0, non_cytoplasmic=1)}, 'P00740': {PhobiusAnnotation(tm_helices=0, signal_peptide=True, cytoplasmic=0, non_cytoplasmic=1)}...(truncated) | 20,350 | {} | 2022-04-09 04:54:25 | |
| ¶ | pypath.inputs.phosphatome.phosphatome_annotations | 2022-04-09 04:54:26 | 2022-04-09 04:54:34 | 7.65 | dict | {'P09923': {PhosphatomeAnnotation(fold='AP', family='AP', subfamily='AP', has_protein_substrates=True, has_non_protein_substrates=True, has_catalytic_activity=True)}, 'P05186': {PhosphatomeAnnotation(fold='AP', family='AP', subfamily='AP', has_protein_substrates=True, has_non_protein_substrates=True...(truncated) | 264 | {} | 2022-04-09 04:54:26 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_enzyme_substrate | 2022-04-09 04:54:34 | 2022-04-09 04:54:37 | 2.57 | list | [{'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 204, 'start': None, 'end': None, 'substrate': 'O14543', 'kinase': 'P06239', 'references': ['12783885'], 'experiment': 'LTP', 'organism': 'Homo sapiens'}, {'instance': None, 'isoform': 1, 'resaa': 'Y', 'resnum': 221, 'start': None, 'end': None...(truncated) | 2,426 | {} | 2022-04-09 04:54:34 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_interactions | 2022-04-09 04:54:37 | 2022-04-09 04:54:37 | 0.50 | list | [['P06239', 'O14543', '12783885', 'Homo sapiens'], ['P06239', 'O14543', '15173187', 'Homo sapiens'], ['P12931', 'O14746', '12808100', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'], ['P06241', 'O15117', '10570256', 'Homo sapiens'], ['P06241', 'O15117', '10409671', 'Homo sapiens'],...(truncated) | 2,426 | {} | 2022-04-09 04:54:37 | |
| ¶ | pypath.inputs.phosphoelm.phosphoelm_kinases | 2022-04-09 04:54:37 | 2022-04-09 04:54:37 | 0.21 | dict | {'AAK1': 'Q2M2I8', 'Abl': 'P00519', 'Abl2': 'P42684', 'Abl_drome': 'P00522', 'Ack_drome': 'Q9VZI2', 'AFK': 'P80197', 'Akt1_drome': 'Q8INB9', 'ALK': 'Q9UM73', 'Atg1_drome': 'Q9VU14', 'ATM': 'Q13315', 'ATR': 'Q13535', 'Aurora A': 'O14965', 'Aurora B': 'Q96GD4', 'Axl': 'P30530', 'BCKDK': 'O14874', 'BLK...(truncated) | 247 | {} | 2022-04-09 04:54:37 | |
| ¶ | pypath.inputs.phosphonetworks.phosphonetworks_enzyme_substrate | 2022-04-09 04:54:37 | 2022-04-09 04:54:39 | 1.37 | list | [{'instance': 'SSYGISETTLEEIFL', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1242, 'score': 1.0162, 'substrate': 'ABCA1', 'start': 1235, 'end': 1249}, {'instance': 'SYGISETTLEEIFLK', 'kinase': 'CSNK2A1', 'resaa': 'T', 'resnum': 1243, 'score': 1.0455, 'substrate': 'ABCA1', 'start': 1236, 'end': 1250...(truncated) | 4,417 | {} | 2022-04-09 04:54:37 | |
| ¶ | pypath.inputs.phosphonetworks.phosphonetworks_interactions | 2022-04-09 04:54:39 | 2022-04-09 04:54:39 | 0.02 | list | [['GSK3B', 'ESR1'], ['HIPK1', 'RPS6KA2'], ['CDK5', 'XRCC1'], ['NEK9', 'ZYX'], ['SYK', 'SHC1'], ['PLK1', 'ZHX1'], ['MAPK14', 'MAPKAPK5'], ['FGFR4', 'MAPK8'], ['RPS6KA1', 'TRIM24'], ['AURKB', 'C14orf106'], ['STK17A', 'SLC4A1AP'], ['CSNK1E', 'RPA1'], ['HIPK1', 'PRKACA'], ['RPS6KB1', 'RAB5B'], ['WEE1', ...(truncated) | 1,821 | {} | 2022-04-09 04:54:39 | |
| ¶ | pypath.inputs.phosphopoint.phosphopoint_directions | 2022-04-09 04:54:39 | 2022-04-09 04:54:39 | 0.44 | list | [('AKT1', 'AKT1'), ('AKT1', 'AKT2'), ('AKT1', 'ESR2'), ('AKT1', 'PHLPP'), ('AKT1', 'APPL'), ('AKT1', 'TCL6'), ('AKT1', 'GRB10'), ('AKT1', 'HSP90AA1'), ('AKT1', 'HSP90AB1'), ('AKT1', 'APLP2'), ('AKT1', 'IKBKB'), ('AKT1', 'ILK'), ('AKT1', 'IMPDH2'), ('AKT1', 'IRS1'), ('AKT1', 'KRT10'), ('AKT1', 'MDM4'...(truncated) | 9,269 | {} | 2022-04-09 04:54:39 | |
| ¶ | pypath.inputs.phosphopoint.phosphopoint_interactions | 2022-04-09 04:54:39 | 2022-04-09 04:54:39 | 0.01 | list | [PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT1', target_entrez='207', category='Category 2'), PhosphopointInteraction(source_genesymbol='AKT1', source_entrez='207', target_genesymbol='AKT2', target_entrez='208', category='Category 2'), PhosphopointInt...(truncated) | 9,269 | {} | 2022-04-09 04:54:39 | |
| ¶ | pypath.inputs.phosphosite._phosphosite_filter_organism |
Not calling `pypath.inputs.phosphosite._phosphosite_filter_organism`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.phosphosite.phosphosite_directions | 2022-04-09 04:54:39 | 2022-04-09 04:54:39 | 0.02 | list | [['P28482', 'Q8N122'], ['Q9NYL2', 'Q9NYL2'], ['P12931', 'P00533'], ['O14757', 'P08631'], ['P45983', 'Q96I25'], ['Q02156', 'O14920'], ['P37173', 'P37173'], ['P31749', 'P49840'], ['Q13153', 'Q96P20'], ['P49840', 'P49840'], ['P45984', 'P46937'], ['P06493', 'Q9GZV5'], ['P11309', 'P52907'], ['O14757', 'Q...(truncated) | 8,971 | {} | 2022-04-09 04:54:39 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_enzyme_substrate | 2022-04-09 04:54:39 | 2022-04-09 04:54:40 | 0.40 | list | [{'kinase': 'Q9BQI3', 'kinase_org': 'human', 'substrate': 'P05198', 'substrate_org': 'human', 'residue': 'S52', 'motif': 'MILLsELsRRRIRsI', 'resaa': 'S', 'resnum': 52, 'start': 45, 'end': 59, 'instance': 'MILLSELSRRRIRSI'}, {'kinase': 'Q9BQI3', 'kinase_org': 'human', 'substrate': 'P05198', 'substrat...(truncated) | 13,127 | {} | 2022-04-09 04:54:39 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions | 2022-04-09 04:54:40 | 2022-04-09 04:54:40 | 0.00 | tuple | ([['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;14530...(truncated) | 2 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_all | 2022-04-09 04:54:40 | 2022-04-09 04:54:40 | 0.00 | list | [['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;145302...(truncated) | 9,041 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_curated | 2022-04-09 04:54:40 | 2022-04-09 04:54:40 | 0.00 | list | [['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;145302...(truncated) | 4,309 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_new | 2022-04-09 04:54:40 | 2022-04-09 04:54:40 | 0.00 | tuple | ([['Q05513', 'P27448', '', 'human', 'AB;MS', '21983960;15174125;15084291;23312004;24719451'], ['P28482', 'Q8N122', 'human', 'human', 'MA', '21071439'], ['Q9NYL2', 'Q9NYL2', 'human', 'human', 'AB;MA', '15342622'], ['P12931', 'P00533', 'human', 'human', 'AB;WB;MS;MA', '20628053;11960379;21278788;14530...(truncated) | 2 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_interactions_noref | 2022-04-09 04:54:40 | 2022-04-09 04:54:40 | 0.00 | list | [['P51451', 'P31995', 'human', 'human', 'MS', ''], ['O14757', 'O60343', 'human', 'human', 'MS', ''], ['Q96GD4', 'Q09666', 'human', 'human', 'MS', ''], ['O14757', 'Q96QD9', 'human', 'human', 'MS', ''], ['P06493', 'O14715', 'human', 'human', 'MS', ''], ['Q5S007', 'P04637', 'human', 'human', 'AB;WB;MA'...(truncated) | 4,732 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_ptm_orthology | 2022-04-09 04:54:40 | 2022-04-09 04:54:46 | 6.60 | dict | {('P31946', 1, 'T', 2, 9606, 'phosphorylation'): {10090: {('Q9CQV8', 1, 'T', 2, 10090, 'phosphorylation')}}, ('Q9CQV8', 1, 'T', 2, 10090, 'phosphorylation'): {9606: {('P31946', 1, 'T', 2, 9606, 'phosphorylation')}}, ('P31946', 1, 'S', 6, 9606, 'phosphorylation'): {10090: {('Q9CQV8', 1, 'S', 6, 10090...(truncated) | 198,541 | {} | 2022-04-09 04:54:40 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_ptms | 2022-04-09 04:54:47 | 2022-04-09 04:55:15 | 28.74 | list | [<PTM Residue YWHAB-1:T2:20q13.12>, <PTM Residue YWHAB-1:S6:20q13.12>, <PTM Residue YWHAB-1:Y21:20q13.12>, <PTM Residue YWHAB-1:T32:20q13.12>, <PTM Residue YWHAB-1:S39:20q13.12>, <PTM Residue YWHAB-1:S47:20q13.12>, <PTM Residue YWHAB-1:Y50:20q13.12>, <PTM Residue YWHAB-1:S59:20q13.12>, <PTM Residue ...(truncated) | 239,701 | {} | 2022-04-09 04:54:47 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_regsites | 2022-04-09 04:55:16 | 2022-04-09 04:55:17 | 1.49 | dict | {'P41181': [{'aa': 'K', 'res': '270', 'modt': 'ub', 'organism': 'human', 'pmids': {'21209006'}, 'induces': [], 'disrupts': [], 'isoform': 1, 'function': {'intracellular localization', 'protein degradation', 'phosphorylation'}, 'process': {''}, 'comments': 'stimulates phosphorylation of S261', 'posit...(truncated) | 5,298 | {} | 2022-04-09 04:55:16 | |
| ¶ | pypath.inputs.phosphosite.phosphosite_regsites_one_organism | 2022-04-09 04:55:18 | 2022-04-09 04:57:55 | 157.46 | dict | {'P41181': {('K', 270, 'ubiquitination'): {'induces': set(), 'disrupts': set(), 'pmids': {'24876223', '21148409', '21209006', '28052875'}, 'isoforms': {1}, 'process': {''}, 'function': {'intracellular localization', 'protein degradation', 'protein stabilization', 'phosphorylation', 'ubiquitination'}...(truncated) | 3,538 | {} | 2022-04-09 04:55:18 | |
| ¶ | pypath.inputs.phosphosite.regsites_tab |
Not calling `pypath.inputs.phosphosite.regsites_tab`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pisa.pisa_bonds |
Not calling `pypath.inputs.pisa.pisa_bonds`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pisa.pisa_interfaces |
Not calling `pypath.inputs.pisa.pisa_interfaces`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pro.get_pro | 2022-04-09 04:57:55 | 2022-04-09 05:03:55 | 360.02 | Obo | <OBO file `https://proconsortium.org/download/current/pro_reasoned.obo`> | 0 | {} | 2022-04-09 04:57:55 | |
| ¶ | pypath.inputs.pro.pro_mapping | 2022-04-09 05:03:55 | 2022-04-09 05:03:55 | 0.38 | list | [('PR:000000005', 'P37173'), ('PR:000000005', 'P38438'), ('PR:000000005', 'Q62312'), ('PR:000000005', 'Q90999'), ('PR:000000007', 'A0A0G2KN81'), ('PR:000000009', 'Q16671'), ('PR:000000009', 'Q62893'), ('PR:000000009', 'Q8K592'), ('PR:000000010', 'O57472'), ('PR:000000010', 'Q24025'), ('PR:000000010'...(truncated) | 319,353 | {} | 2022-04-09 05:03:55 | |
| ¶ | pypath.inputs.progeny.progeny_annotations | 2022-04-09 05:03:56 | 2022-04-09 05:04:14 | 18.21 | dict | {'P35250': {ProgenyAnnotation(pathway='TNFa', weight=-0.12499324201483122, p_value=0.8334557980340556), ProgenyAnnotation(pathway='EGFR', weight=1.4706466171905381, p_value=0.0016552751715941223), ProgenyAnnotation(pathway='TGFb', weight=-0.430508102546081, p_value=0.6304595613186617), ProgenyAnnota...(truncated) | 18,598 | {} | 2022-04-09 05:03:56 | |
| ¶ | pypath.inputs.progeny.progeny_raw | 2022-04-09 05:04:14 | 2022-04-09 05:04:16 | 2.04 | DataFrame | gene pathway weight p.value 0 RFC2 EGFR 1.470647 0.001655 1 ESRRA EGFR 0.178590 0.211838 2 HNRNPK EGFR 0.306699 0.084560 3 CBX6 EGFR -0.675507 0.017641 4 ASRGL1 EGFR -0.252328 0.295430 ... ... ... ...(truncated) | 274,143 | {} | 2022-04-09 05:04:14 | |
| ¶ | pypath.inputs.proteinatlas.get_proteinatlas | 2022-04-09 05:04:16 | 2022-04-09 05:05:52 | 96.21 | dict | {'normal': {'adipose tissue:adipocytes': {'O43657': ('Not detected', 'Approved'), 'O60762': ('Medium', 'Approved'), 'Q8IZE3': ('Low', 'Approved'), 'Q9NSG2': ('Medium', 'Uncertain'), 'P09769': ('Not detected', 'Enhanced'), 'P08603': ('Not detected', 'Supported'), 'Q9BTY2': ('Not detected', 'Approved'...(truncated) | 2 | {} | 2022-04-09 05:04:16 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_annotations | 2022-04-09 05:05:54 | 2022-04-09 05:08:34 | 160.39 | dict | {'O43657': {ProtainatlasAnnotation(organ='duodenum', tissue='glandular cells', level='Low', status='Approved', n_not_detected=None, n_low=None, n_medium=None, n_high=None, prognostic=False, favourable=False, score=None, pathology=False), ProtainatlasAnnotation(organ='lymph node', tissue='non-germina...(truncated) | 19,373 | {} | 2022-04-09 05:05:54 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_secretome_annotations | 2022-04-09 05:08:37 | 2022-04-09 05:08:39 | 2.09 | dict | {'P10646': {ProteinatlasSecretomeAnnotation(mainclass='Secreted to blood', secreted=True)}, 'P20701': {ProteinatlasSecretomeAnnotation(mainclass='Intracellular or membrane-bound', secreted=False)}, 'Q9NPA2': {ProteinatlasSecretomeAnnotation(mainclass='Secreted to blood', secreted=True)}, 'Q03405': {...(truncated) | 2,591 | {} | 2022-04-09 05:08:37 | |
| ¶ | pypath.inputs.proteinatlas.proteinatlas_subcellular_annotations | 2022-04-09 05:08:39 | 2022-04-09 05:08:40 | 1.31 | dict | {'Q8IZE3': {ProteinatlasSubcellularAnnotation(location='Nuclear bodies', status='Uncertain'), ProteinatlasSubcellularAnnotation(location='Microtubules', status='Uncertain')}, 'P23511': {ProteinatlasSubcellularAnnotation(location='Nucleoplasm', status='Supported')}, 'Q9Y4W2': {ProteinatlasSubcellular...(truncated) | 6,821 | {} | 2022-04-09 05:08:39 | |
| ¶ | pypath.inputs.protmapper.get_protmapper | 2022-04-09 05:08:40 | 2022-04-09 05:08:45 | 5.43 | tuple | ([{'ID': '0', 'CTRL_NS': 'UP', 'CTRL_ID': 'Q02156', 'CTRL_GENE_NAME': 'PRKCE', 'CTRL_IS_KINASE': 'True', 'TARGET_UP_ID': 'P15336', 'TARGET_GENE_NAME': 'ATF2', 'TARGET_RES': 'T', 'TARGET_POS': '52', 'SOURCES': 'psp,reach,signor,sparser'}, {'ID': '1', 'CTRL_NS': 'FPLX', 'CTRL_ID': 'PKC', 'CTRL_GENE_NA...(truncated) | 2 | {} | 2022-04-09 05:08:40 | |
| ¶ | pypath.inputs.protmapper.protmapper_enzyme_substrate | 2022-04-09 05:08:46 | 2022-04-09 05:08:46 | 0.72 | list | [{'kinase': 'Q02156', 'resaa': 'T', 'resnum': 52, 'references': {'25728676', '24357804', '22304920', '24727247', '25545367'}, 'substrate': 'P15336', 'databases': {'PhosphoSite', 'REACH', 'Sparser', 'SIGNOR'}}, {'kinase': 'Q02156', 'resaa': 'T', 'resnum': 280, 'references': {'23708658', '24727247'}, ...(truncated) | 22,139 | {} | 2022-04-09 05:08:46 | |
| ¶ | pypath.inputs.protmapper.protmapper_interactions |
Not calling `pypath.inputs.protmapper.protmapper_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubchem.pubchem_mapping |
Not calling `pypath.inputs.pubchem.pubchem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.get_pmid |
Not calling `pypath.inputs.pubmed.get_pmid`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.get_pubmeds |
Not calling `pypath.inputs.pubmed.get_pubmeds`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.only_pmids |
Not calling `pypath.inputs.pubmed.only_pmids`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.open_pubmed |
Not calling `pypath.inputs.pubmed.open_pubmed`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.pmids_dict |
Not calling `pypath.inputs.pubmed.pmids_dict`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.pubmed.pmids_list |
Not calling `pypath.inputs.pubmed.pmids_list`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.ramilowski2015.ramilowski_interactions | 2022-04-09 05:08:47 | 2022-04-09 05:08:47 | 0.56 | list | [Ramilowski2015Interaction(ligand='A2M', receptor='LRP1', references='', resources='HPMR;HPRD;STRING.binding;STRING.experiment;literature supported'), Ramilowski2015Interaction(ligand='AANAT', receptor='MTNR1A', references='', resources='HPMR;literature supported'), Ramilowski2015Interaction(ligand=...(truncated) | 1,894 | {} | 2022-04-09 05:08:47 | |
| ¶ | pypath.inputs.ramilowski2015.ramilowski_locations | 2022-04-09 05:08:47 | 2022-04-09 05:09:26 | 38.91 | dict | {'P04217': {RamilowskiLocation(location='secreted', source='UniProt', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='LocTree3', tmh=0, note=None, long_note=None), RamilowskiLocation(location='secreted', source='Consensus6', tmh=0, note=None, long_note=None), Ramil...(truncated) | 18,861 | {} | 2022-04-09 05:08:47 | |
| ¶ | pypath.inputs.rdata._patch_rdata | 2022-04-09 05:09:26 | 2022-04-09 05:09:26 | 0.00 | NoneType | None | 0 | {} | 2022-04-09 05:09:26 | |
| ¶ | pypath.inputs.rdata._rdata_data_frame_get_rownames |
Not calling `pypath.inputs.rdata._rdata_data_frame_get_rownames`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.rdata._rdata_list_get_names |
Not calling `pypath.inputs.rdata._rdata_list_get_names`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._bp_collect_resources |
Not calling `pypath.inputs.reaction._bp_collect_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._process_controls |
Not calling `pypath.inputs.reaction._process_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_collect_resources |
Not calling `pypath.inputs.reaction._reactome_collect_resources`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_collect_species |
Not calling `pypath.inputs.reaction._reactome_collect_species`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_compartment |
Not calling `pypath.inputs.reaction._reactome_compartment`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_extract_id |
Not calling `pypath.inputs.reaction._reactome_extract_id`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_extract_res |
Not calling `pypath.inputs.reaction._reactome_extract_res`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_id |
Not calling `pypath.inputs.reaction._reactome_id`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_reaction |
Not calling `pypath.inputs.reaction._reactome_reaction`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_reactions | 2022-04-09 05:09:26 | 2022-04-09 05:12:13 | 166.50 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/reaction.py", line 985, in _reactome_reactions
for i in sp.find('bqbiol:haspart').find_all('rdf:li'):
AttributeError: 'NoneType' object has no attribute 'find_all'
|
{} | 2022-01-08 00:48:01 | |||
| ¶ | pypath.inputs.reaction._reactome_reactions_et | 2022-04-09 05:12:13 | 2022-04-09 05:12:15 | 2.07 | tuple | ({}, {}, {}) | 3 | {} | 2022-04-09 05:12:13 | |
| ¶ | pypath.inputs.reaction._reactome_res |
Not calling `pypath.inputs.reaction._reactome_res`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction._reactome_species |
Not calling `pypath.inputs.reaction._reactome_species`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.acsn_biopax | 2022-04-09 05:12:15 | 2022-04-09 05:12:24 | 9.41 | list | ['<?xml version="1.0" encoding="UTF-8"?>\n', '<rdf:RDF\n', ' xmlns:xsd="http://www.w3.org/2001/XMLSchema#"\n', ' xmlns:owl="http://www.w3.org/2002/07/owl#"\n', ' xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"\n', ' xmlns:bp="http://www.biopax.org/release/biopax-level3.owl#"\n', ' xml:base="...(truncated) | 190,854 | {} | 2022-04-09 05:12:15 | |
| ¶ | pypath.inputs.reaction.acsn_interactions_2 |
Not calling `pypath.inputs.reaction.acsn_interactions_2`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_acsn_effects | 2022-04-09 05:12:24 | 2022-04-09 05:12:24 | 0.24 | list | [['FOXO3', 'PIK3CA', '*'], ['FOXO3', 'PIK3CB', '*'], ['FOXO3', 'PIK3CD', '*'], ['FOXO3', 'PIK3CG', '*'], ['AKT1', 'HOMER3', '*'], ['AKT2', 'HOMER3', '*'], ['AKT3', 'HOMER3', '*'], ['CDH2', 'HOMER3', '*'], ['CDK6', 'CDKN2B', '*'], ['ANAPC2', 'RSPO3', '*'], ['AXIN1', 'RSPO3', '*'], ['AXIN2', 'RSPO3', ...(truncated) | 37,288 | {} | 2022-04-09 05:12:24 | |
| ¶ | pypath.inputs.reaction.get_controls |
Not calling `pypath.inputs.reaction.get_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_interactions |
Not calling `pypath.inputs.reaction.get_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.get_reactions | 2022-04-09 05:12:24 | 2022-04-09 05:14:17 | 112.68 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 785, in test_input
for i, rec in enumerate(value_gen):
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/reaction.py", line 1186, in get_reactions
rea.load_all()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/pyreact.py", line 1301, in load_all
self.load_panther()
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/utils/pyreact.py", line 1213, in load_panther
len(biopaxes.files_multipart),
AttributeError: 'Curl' object has no attribute 'files_multipart'
|
{} | 2022-01-08 00:48:07 | |||
| ¶ | pypath.inputs.reaction.get_soup |
Not calling `pypath.inputs.reaction.get_soup`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.panther_biopax | 2022-04-09 05:14:17 | 2022-04-09 05:14:20 | 3.34 | NoneType | None | 0 | {} | 2022-04-09 05:14:17 | |
| ¶ | pypath.inputs.reaction.panther_interactions |
Not calling `pypath.inputs.reaction.panther_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.pid_biopax | 2022-04-09 05:14:20 | 2022-04-09 05:14:23 | 2.37 | NoneType | None | 0 | {} | 2022-04-09 05:14:20 | |
| ¶ | pypath.inputs.reaction.pid_interactions |
Not calling `pypath.inputs.reaction.pid_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_complex |
Not calling `pypath.inputs.reaction.process_complex`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_controls |
Not calling `pypath.inputs.reaction.process_controls`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.process_reactions |
Not calling `pypath.inputs.reaction.process_reactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactions_biopax |
Not calling `pypath.inputs.reaction.reactions_biopax`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactome_biopax | 2022-04-09 05:14:23 | 2022-04-09 05:20:23 | 360.02 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/reaction.py", line 91, in reactome_biopax
fileobj = c.result[fname]
TypeError: 'NoneType' object is not subscriptable
|
{} | 2022-04-01 01:55:29 | |||
| ¶ | pypath.inputs.reaction.reactome_bs | 2022-04-09 05:20:23 | 2022-04-09 05:26:33 | 370.52 | list | [('R-HSA-1059683', <?xml version='1.0' encoding='utf-8' standalone='no'?> <sbml level="3" version="1" xmlns="http://www.sbml.org/sbml/level3/version1/core"> <notes> <annotation> <p xmlns="http://www.w3.org/1999/xhtml">SBML generated from Reactome version 80 on 3/28/22, 2:56 AM using JSBML version 1....(truncated) | 2,580 | {'size': 27} | 2022-04-09 05:20:23 | |
| ¶ | pypath.inputs.reaction.reactome_interactions |
Not calling `pypath.inputs.reaction.reactome_interactions`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.reaction.reactome_sbml | 2022-04-09 05:26:51 | 2022-04-09 05:26:53 | 2.07 | dict | {'R-HSA-1059683.sbml': <ExFileObject name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/cache/9cfb9d56283cf7ad3077ba1f8a187542-homo_sapiens.3.1.sbml.tgz'>, 'R-HSA-109581.sbml': <ExFileObject name='/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-00130...(truncated) | 2,580 | {'size': 27} | 2022-04-09 05:26:51 | |
| ¶ | pypath.inputs.scconnect.scconnect_annotations | 2022-04-09 05:26:53 | 2022-04-09 05:26:54 | 0.97 | dict | {'P41273': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human')}, 'P20292': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human')}, 'P01189': {ScconnectAnnotation(role='ligand', family=None, type=None, inferred_from='human'), ScconnectAnnota...(truncated) | 3,285 | {} | 2022-04-09 05:26:53 | |
| ¶ | pypath.inputs.scconnect.scconnect_complexes | 2022-04-09 05:26:54 | 2022-04-09 05:26:54 | 0.21 | set | {Complex: COMPLEX:P0DML2_P0DML3, Complex: COMPLEX:P01215_P01229, Complex: COMPLEX:P0DP23_P0DP24_P0DP25, Complex: COMPLEX:P29460_Q9NPF7, Complex: COMPLEX:Q14213_Q8NEV9, Complex: COMPLEX:P01215_P01225, Complex: COMPLEX:P01374_Q06643, Complex: COMPLEX:P01562, Complex: COMPLEX:P01215_P01222, Complex: CO...(truncated) | 17 | {} | 2022-04-09 05:26:54 | |
| ¶ | pypath.inputs.scconnect.scconnect_interactions | 2022-04-09 05:26:54 | 2022-04-09 05:42:09 | 915.38 | list | [ScconnectInteraction(ligand_id='ML355', target_id='P18054', ligand_organism=None, target_organism=9606, ligand_type='small_molecule', target_type='protein', effect='Inhibition', references='24393039'), ScconnectInteraction(ligand_id='PKUMDL_MH_1001', target_id='P16050', ligand_organism=None, target...(truncated) | 20,434 | {} | 2022-04-09 05:26:54 | |
| ¶ | pypath.inputs.science.science_download |
Not calling `pypath.inputs.science.science_download`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.signalink.signalink_annotations | 2022-04-09 05:42:10 | 2022-04-09 05:42:18 | 8.70 | dict | {'pathway': {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Innate immune pathways'), SignalinkPathway(pathway='JAK/STAT'), SignalinkPathway(p...(truncated) | 2 | {} | 2022-04-09 05:42:10 | |
| ¶ | pypath.inputs.signalink.signalink_function_annotations | 2022-04-09 05:42:18 | 2022-04-09 05:42:19 | 0.92 | dict | {'P43403': {SignalinkFunction(function='Mediator'), SignalinkFunction(function='Scaffold')}, 'Q9NYJ8': {SignalinkFunction(function='Scaffold'), SignalinkFunction(function='Co-factor')}, 'O43318': {SignalinkFunction(function='Mediator')}, 'P15018': {SignalinkFunction(function='Ligand')}, 'P42702': {S...(truncated) | 784 | {} | 2022-04-09 05:42:18 | |
| ¶ | pypath.inputs.signalink.signalink_interactions | 2022-04-09 05:42:19 | 2022-04-09 05:42:20 | 0.43 | list | [SignalinkInteraction(id_a='P20963', id_b='P43403', is_direct=True, is_directed=True, effect=0, pathways_a=['T-cell receptor'], pathways_b=['Receptor tyrosine kinase', 'T-cell receptor'], functions_a=[], functions_b=['Mediator', 'Scaffold'], references=['10358158', '10358164', '10562324', '10925299'...(truncated) | 1,939 | {} | 2022-04-09 05:42:19 | |
| ¶ | pypath.inputs.signalink.signalink_pathway_annotations | 2022-04-09 05:42:20 | 2022-04-09 05:42:20 | 0.62 | dict | {'P20963': {SignalinkPathway(pathway='T-cell receptor')}, 'P43403': {SignalinkPathway(pathway='T-cell receptor'), SignalinkPathway(pathway='Receptor tyrosine kinase')}, 'Q9NYJ8': {SignalinkPathway(pathway='Innate immune pathways'), SignalinkPathway(pathway='JAK/STAT'), SignalinkPathway(pathway='Toll...(truncated) | 836 | {} | 2022-04-09 05:42:20 | |
| ¶ | pypath.inputs.signor.signor_complexes | 2022-04-09 05:42:20 | 2022-04-09 05:42:21 | 0.80 | dict | {'COMPLEX:P23511_P25208_Q13952': Complex NFY: COMPLEX:P23511_P25208_Q13952, 'COMPLEX:P42345_P68104_P85299_Q6R327_Q8TB45_Q9BVC4': Complex mTORC2: COMPLEX:P42345_P68104_P85299_Q6R327_Q8TB45_Q9BVC4, 'COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4': Complex mTORC1: COMPLEX:P42345_Q8N122_Q8TB45_Q96B36_Q9BVC4...(truncated) | 3,211 | {} | 2022-04-09 05:42:20 | |
| ¶ | pypath.inputs.signor.signor_enzyme_substrate | 2022-04-09 05:42:21 | 2022-04-09 05:42:43 | 21.82 | list | [{'typ': 'phosphorylation', 'resnum': 179, 'instance': 'MKKKDEGSYDLGKKP', 'substrate': 'P31431', 'start': 172, 'end': 186, 'kinase': 'Q05655', 'resaa': 'S', 'motif': 'MKKKDEGSYDLGKKP', 'enzyme_isoform': None, 'substrate_isoform': None, 'references': {'11916978'}}, {'typ': 'phosphorylation', 'resnum'...(truncated) | 9,985 | {} | 2022-04-09 05:42:21 | |
| ¶ | pypath.inputs.signor.signor_interactions | 2022-04-09 05:42:43 | 2022-04-09 05:42:43 | 0.43 | list | [SignorInteraction(source='P34981', target='P29992', source_isoform=None, target_isoform=None, source_type='protein', target_type='protein', effect='up-regulates activity', mechanism='binding', ncbi_tax_id='9606', pubmeds='27515033', direct=True, ptm_type='binding', ptm_residue='', ptm_motif=''), Si...(truncated) | 36,564 | {} | 2022-04-09 05:42:43 | |
| ¶ | pypath.inputs.signor.signor_pathway_annotations | 2022-04-09 05:42:43 | 2022-04-09 05:43:13 | 29.63 | dict | {'Q969H0': {SignorPathway(pathway='Acute Myeloid Leukemia')}, 'Q8TEK3': {SignorPathway(pathway='Acute Myeloid Leukemia')}, 'P42771': {SignorPathway(pathway='Rhabdomyosarcoma'), SignorPathway(pathway='Acute Myeloid Leukemia'), SignorPathway(pathway='Cell cycle: G2/M phase transition'), SignorPathway(...(truncated) | 645 | {} | 2022-04-09 05:42:43 | |
| ¶ | pypath.inputs.signor.signor_pathways |
Not calling `pypath.inputs.signor.signor_pathways`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.signor.signor_protein_families | 2022-04-09 05:43:13 | 2022-04-09 05:43:13 | 0.00 | dict | {'SIGNOR-PF1': ['P28482', 'P27361'], 'SIGNOR-PF2': ['Q9HBW0', 'Q9UBY5', 'Q92633'], 'SIGNOR-PF3': ['O14610', 'O60262', 'Q9P2W3', 'P63215', 'P63211', 'P50150', 'P59768', 'P63218', 'P61952', 'Q9UK08', 'Q9UBI6', 'P50151'], 'SIGNOR-PF4': ['P28482', 'P27361'], 'SIGNOR-PF5': ['P01137', 'P10600', 'P61812'],...(truncated) | 93 | {} | 2022-04-09 05:43:13 | |
| ¶ | pypath.inputs.spike.spike_interactions | 2022-04-09 05:43:13 | 2022-04-09 05:43:31 | 18.40 | list | [['836', 'CASP3', '8669', 'EIF3J', '1', '10672017', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['836', 'CASP3', '3691', 'ITGB4', '1', '17178732', '1', '2', '', 'Published research', '', 'Proteolytic Processing'], ['407042', 'MIR34C', '4609', 'MYC', '1', '20212154', '1', '2', ...(truncated) | 3,842 | {} | 2022-04-09 05:43:13 | |
| ¶ | pypath.inputs.stitch.stitch_actions_interactions | 2022-04-09 05:43:31 | 2022-04-09 05:46:16 | 164.32 | list | [StitchActionsInteraction(partner_a='00010461', partner_b='ENSP00000170630', mechanism='expression', action=None, score=150), StitchActionsInteraction(partner_a='00010461', partner_b='ENSP00000170630', mechanism='expression', action=None, score=150), StitchActionsInteraction(partner_a='23627457', pa...(truncated) | 21,773,491 | {} | 2022-04-09 05:43:31 | |
| ¶ | pypath.inputs.stitch.stitch_links_interactions | 2022-04-09 05:46:16 | 2022-04-09 05:48:06 | 110.57 | list | [StitchLinksInteraction(partner_a='91663464', partner_b='ENSP00000354652', experimental=989, prediction=0, database=0, textmining=0, combined_score=989, physical_combined_score=996), StitchLinksInteraction(partner_a='90668081', partner_b='ENSP00000317985', experimental=933, prediction=0, database=0,...(truncated) | 150,645 | {} | 2022-04-09 05:46:16 | |
| ¶ | pypath.inputs.string.string_effects | 2022-04-09 05:48:06 | 2022-04-09 05:48:18 | 11.60 | list | [StringEffectsInteraction(source='ENSP00000216366', target='ENSP00000000233', effect='*'), StringEffectsInteraction(source='ENSP00000000233', target='ENSP00000216366', effect='*'), StringEffectsInteraction(source='ENSP00000222547', target='ENSP00000000233', effect='*'), StringEffectsInteraction(sour...(truncated) | 2,250,122 | {} | 2022-04-09 05:48:06 | |
| ¶ | pypath.inputs.string.string_links_interactions | 2022-04-09 05:48:19 | 2022-04-09 05:49:12 | 52.84 | list | [StringLinksInteraction(protein_a='ENSP00000000233', protein_b='ENSP00000440005', neighborhood_score=0, fusion=0, cooccurence=50, coexpression=99, experimental=679, database=900, textmining=59, combined_score=969, physical_combined_score=740), StringLinksInteraction(protein_a='ENSP00000000233', prot...(truncated) | 247,200 | {} | 2022-04-09 05:48:19 | |
| ¶ | pypath.inputs.string.string_physical_interactions | 2022-04-09 05:49:12 | 2022-04-09 05:49:14 | 1.69 | list | [StringPhysicalInteraction(protein_a='ENSP00000000412', protein_b='ENSP00000221957', experimental=483, database=600, textmining=821, combined_score=959), StringPhysicalInteraction(protein_a='ENSP00000000412', protein_b='ENSP00000438085', experimental=932, database=0, textmining=0, combined_score=932...(truncated) | 83,896 | {} | 2022-04-09 05:49:12 | |
| ¶ | pypath.inputs.surfaceome.surfaceome_annotations | 2022-04-09 05:49:14 | 2022-04-09 05:49:21 | 6.70 | dict | {'A0AV02': (0.8363, 'Transporters', {'APC', 'SLC', 'SLC12'}), 'A0FGR9': (0.0465, 'Unclassified', {'Unclassified'}), 'A0PJK1': (0.8802, 'Transporters', {'APC', 'SLC', 'SLC5'}), 'A0PK11': (0.6108, 'Unclassified', {'Unclassified'}), 'A0ZSE6': (0.6327, 'Miscellaneous', {'Unknown_function', 'TMEM30'}), '...(truncated) | 2,808 | {} | 2022-04-09 05:49:14 | |
| ¶ | pypath.inputs.switches_elm.get_switches_elm | 2022-04-09 05:49:21 | 2022-04-09 05:52:37 | 195.97 |
Traceback (most recent call last):
File "/home/omnipath/testing/pypath-inputs/./status-report.py", line 765, in test_input
value = fun(*_args, **_kwargs)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/switches_elm.py", line 95, in get_switches_elm
mod_ont = ontology.ontology('MOD')
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/ontology.py", line 46, in ontology
result = ebi.ebi_rest(url = url, fields = _fields)
File "/home/omnipath/testing/pypath-inputs/pypath_inputs_status__20220409-001302/pypath/inputs/ebi.py", line 73, in ebi_rest
this_result = json.loads(c.result)
File "/usr/lib/python3.9/json/__init__.py", line 339, in loads
raise TypeError(f'the JSON object must be str, bytes or bytearray, '
TypeError: the JSON object must be str, bytes or bytearray, not NoneType
|
{} | 2022-04-02 05:49:39 | |||
| ¶ | pypath.inputs.talklr.talklr_annotations | 2022-04-09 05:52:37 | 2022-04-09 05:52:37 | 0.72 | dict | {'P01023': {TalklrAnnotation(role='ligand', pmid=None, putative=False)}, 'Q07954': {TalklrAnnotation(role='receptor', pmid=None, putative=False), TalklrAnnotation(role='receptor', pmid='11560994', putative=False), TalklrAnnotation(role='receptor', pmid='21054788', putative=False)}, 'Q16613': {Talklr...(truncated) | 1,345 | {} | 2022-04-09 05:52:37 | |
| ¶ | pypath.inputs.talklr.talklr_interactions | 2022-04-09 05:52:37 | 2022-04-09 05:52:37 | 0.04 | list | [TalklrInteraction(ligand='A2M', receptor='LRP1', pmids=(), resources=('HPRD', 'STRING', 'HPMR'), putative=False), TalklrInteraction(ligand='AANAT', receptor='MTNR1A', pmids=(), resources=('HPMR',), putative=False), TalklrInteraction(ligand='AANAT', receptor='MTNR1B', pmids=(), resources=('HPMR',), ...(truncated) | 2,422 | {} | 2022-04-09 05:52:37 | |
| ¶ | pypath.inputs.talklr.talklr_raw | 2022-04-09 05:52:37 | 2022-04-09 05:52:37 | 0.03 | DataFrame | Pair_Name Ligand_ApprovedSymbol ... Pair_Source Pair_Evidence 0 A2M_LRP1 A2M ... known literature supported 1 AANAT_MTNR1A AANAT ... known literature supported 2 AANAT_MTNR1B AANAT ... known l...(truncated) | 2,422 | {} | 2022-04-09 05:52:37 | |
| ¶ | pypath.inputs.tcdb.tcdb_annotations | 2022-04-09 05:52:37 | 2022-04-09 05:52:47 | 9.93 | dict | {'P60201': {TcdbAnnotation(family='Myelin Proteolipid Protein (MPLP)', tcid='9.B.38.1.2')}, 'Q9NWF4': {TcdbAnnotation(family='Eukaryotic Riboflavin Transporter (E-RFT)', tcid='2.A.125.1.1')}, 'O00161': {TcdbAnnotation(family='Synaptosomal Vesicle Fusion Pore (SVF-Pore)', tcid='1.F.1.1.1')}, 'O00299'...(truncated) | 2,047 | {} | 2022-04-09 05:52:37 | |
| ¶ | pypath.inputs.tcdb.tcdb_classes | 2022-04-09 05:52:47 | 2022-04-09 05:52:47 | 0.03 | dict | {'A0CIB0': ('1.A.17.1.13', '1.A.17'), 'A0CS82': ('9.B.82.1.5', '9.B.82'), 'A0CX44': ('1.A.3.2.4', '1.A.3'), 'A0D5K0': ('2.A.66.3.4', '2.A.66'), 'A0E9B5': ('9.B.38.2.1', '9.B.38'), 'A0ECD9': ('3.A.1.207.1', '3.A.1'), 'A0FKN5': ('2.A.53.2.9', '2.A.53'), 'A0JCJ5': ('1.B.1.1.7', '1.B.1'), 'A0JSP2': ('3....(truncated) | 21,887 | {'size': 5} | 2022-04-09 05:52:47 | |
| ¶ | pypath.inputs.tcdb.tcdb_families | 2022-04-09 05:52:47 | 2022-04-09 05:52:47 | 0.01 | dict | {'1.A.1': 'Voltage-gated Ion Channel (VIC)', '1.A.10': 'Glutamate-gated Ion Channel (GIC) of Neurotransmitter Receptors', '1.A.100': 'Rhabdoviridae Putative Viroporin, U5 (RV-U5)', '1.A.101': 'Peroxisomal Pore-forming Pex11 (Pex11)', '1.A.102': 'Influenza A viroporin PB1-F2 (PB1-F2)', '1.A.103': 'Si...(truncated) | 1,667 | {'size': 1} | 2022-04-09 05:52:47 | |
| ¶ | pypath.inputs.tfcensus.tfcensus_annotations | 2022-04-09 05:52:47 | 2022-04-09 05:52:48 | 0.63 | dict | {'P23511': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'Q96QS3': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P31270': {TfcensusAnnotation(tfcensus_class='a', tissue='uterus')}, 'P57073': {TfcensusAnnotation(tfcensus_class='a', tissue=None)}, 'P17010': {TfcensusAnnotation(tfcen...(truncated) | 1,885 | {} | 2022-04-09 05:52:47 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_chains | 2022-04-09 05:52:48 | 2022-04-09 05:53:18 | 30.14 | dict | {'code': {'ch_new': 'ch_old'}, '4b5m_1': {'L': 'L', 'A': 'A', 'V': 'V', 'U': 'U'}, '4b5m_2': {'W': 'W', 'M': 'M', 'B': 'B', 'X': 'X'}, '4b5m_3': {'N': 'N', 'Z': 'Z', 'C': 'C', 'Y': 'Y'}, '4abk_1': {'A': 'A'}, '1lsz_1': {'A': 'A'}, '3gll_1': {'C': 'A', 'A': 'A', 'B': 'A'}, '1hz6_4': {'C': 'C', 'A': '...(truncated) | 174,325 | {} | 2022-04-09 05:52:48 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_contacts | 2022-04-09 05:53:18 | 2022-04-09 05:55:31 | 132.77 | set | {ThreedcomplexContact(pdb='3f9k_10', uniprot_1='P04584', uniprot_2='P04584', chain_1='l', chain_2='k', n_residues=29.5, length_1=196, length_2=204, domain_s1=('46919', '53098'), domain_p1=('PF02022.14', 'PF00665.21'), domain_s2=('46919', '53098'), domain_p2=('PF02022.14', 'PF00665.21'), ident=True, ...(truncated) | 260,251 | {'size': 12} | 2022-04-09 05:53:18 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_ddi | 2022-04-09 05:55:32 | 2022-04-09 05:58:35 | 183.08 | list | [<pypath.internals.intera.DomainDomain object at 0x7feba79aad30>, <pypath.internals.intera.DomainDomain object at 0x7feba79aad90>, <pypath.internals.intera.DomainDomain object at 0x7feba79aaee0>, <pypath.internals.intera.DomainDomain object at 0x7feba79aae80>, <pypath.internals.intera.DomainDomain o...(truncated) | 525,440 | {'size': 12} | 2022-04-09 05:55:32 | |
| ¶ | pypath.inputs.threedcomplex.threedcomplex_nresidues | 2022-04-09 05:58:36 | 2022-04-09 05:58:44 | 8.03 | dict | {'3f9k_10': {('P04584', 'P04584'): 29.5, ('O75475', 'P04584'): 7.5}, '4x6z_1': {('P23639', 'P40302'): 1.0, ('P22141', 'P40303'): 7.5, ('P22141', 'P30656'): 14.0, ('P22141', 'P25451'): 13.5, ('P23724', 'P32379'): 9.0, ('P23724', 'P25043'): 26.5, ('P30656', 'P32379'): 9.0, ('P23638', 'P40303'): 35.5, ...(truncated) | 81,385 | {'size': 4} | 2022-04-09 05:58:36 | |
| ¶ | pypath.inputs.threedid.get_3did | 2022-04-09 05:58:44 | 2022-04-09 06:48:22 | 2,978.00 | tuple | ([<pypath.internals.intera.DomainDomain object at 0x7febb59d5d90>, <pypath.internals.intera.DomainDomain object at 0x7febb59d5a30>, <pypath.internals.intera.DomainDomain object at 0x7febb59d5dc0>, <pypath.internals.intera.DomainDomain object at 0x7febb59d53a0>, <pypath.internals.intera.DomainDomain ...(truncated) | 2 | {} | 2022-04-09 05:58:44 | |
| ¶ | pypath.inputs.threedid.get_3did_ddi | 2022-04-09 06:48:22 | 2022-04-09 06:48:53 | 30.81 | dict | {('P30048', 'Q9BYN0'): {('PF10417', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0'], '3hy2': ['Q06830', 'Q9BYN0']}}, ('PF00578', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0'], '3hy2': ['Q06830', 'Q9BYN0']}}}, ('P30041', 'Q9BYN0'): {('PF10417', 'PF02195'): {'pdbs': {'2rii': ['Q06830', 'Q9BYN0...(truncated) | 3,274,970 | {} | 2022-04-09 06:48:22 | |
| ¶ | pypath.inputs.topdb.topdb_annotations | 2022-04-09 06:50:04 | 2022-04-09 06:50:08 | 4.39 | dict | {'P05067': {TopdbAnnotation(membrane='Plasma membrane', topology='Signal', score=89, tmregions=1), TopdbAnnotation(membrane='Extracellular', topology='Signal', score=89, tmregions=1), TopdbAnnotation(membrane='Plasma membrane', topology='Outside', score=89, tmregions=1), TopdbAnnotation(membrane='Ex...(truncated) | 1,248 | {'size': 3} | 2022-04-09 06:50:04 | |
| ¶ | pypath.inputs.transmir.transmir_interactions | 2022-04-09 06:50:08 | 2022-04-09 06:50:09 | 0.71 | list | [TransmirInteraction(tf_genesymbol='AGO2', mirna='hsa-mir-155', effect='Repression', pubmed='24263100'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-106b', effect='Activation', pubmed='24798859'), TransmirInteraction(tf_genesymbol='AHR', mirna='hsa-mir-132', effect='Activation', pubmed='...(truncated) | 2,678 | {} | 2022-04-09 06:50:08 | |
| ¶ | pypath.inputs.trip.take_a_trip | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.01 | dict | {'sc': {('P48995', 'Q12791'): [['TRPC1', '', 'BKca', 'Inference', '', '', '', '', '', 'Prediction', '19168436']], ('P48995', 'Q13873'): [['TRPC1', '', 'BMPR-2', 'Affinity purification-mass spectrometry', 'Not used as a bait', '', 'Mouse', 'Leg muscle', 'C2C12 lysates', '', '15188402']], ('P48995', '...(truncated) | 5 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.trip.trip_find_uniprot |
Not calling `pypath.inputs.trip.trip_find_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.trip.trip_get_uniprot |
Not calling `pypath.inputs.trip.trip_get_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.trip.trip_interactions | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.01 | list | [['P48995', 'Q12791', '25139746;19168436', 'Co-immunoprecipitation;Co-immunofluorescence staining', 'unknown'], ['P48995', 'Q08209', '23228564', 'Co-immunoprecipitation', 'unknown'], ['P48995', 'P62158', '11290752;11983166;12601176', 'Calcium measurement;Fluorescence probe labeling;Fusion protein-pu...(truncated) | 359 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.trip.trip_process | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.01 | dict | {('P48995', 'Q12791'): {'refs': {'25139746', '19168436'}, 'methods': {'Co-immunoprecipitation', 'Co-immunofluorescence staining'}, 'tissues': {'Porcine coronary artery', 'Rat vascular smooth muscle cell', 'HEK293', 'Rat aortic vascular smooth muscle cell'}, 'effect': set(), 'regions': set()}, ('P489...(truncated) | 359 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.trip.trip_process_table |
Not calling `pypath.inputs.trip.trip_process_table`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem._unichem_mapping |
Not calling `pypath.inputs.unichem._unichem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.info |
Not calling `pypath.inputs.unichem.info`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.unichem_info | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.02 | list | [UnichemSource(number='1', label='chembl', name='ChEMBL', description='A database of bioactive drug-like small molecules and bioactivities abstracted from the scientific literature.', acquisition='Standard InChIs and Keys provided on ftp site for each release.'), UnichemSource(number='2', label='dru...(truncated) | 40 | {'size': -1} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.unichem.unichem_mapping |
Not calling `pypath.inputs.unichem.unichem_mapping`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.unichem.unichem_sources | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.02 | dict | {'1': 'chembl', '2': 'drugbank', '3': 'pdb', '4': 'gtopdb', '5': 'pubchem_dotf', '6': 'kegg_ligand', '7': 'chebi', '8': 'nih_ncc', '9': 'zinc', '10': 'emolecules', '12': 'atlas', '14': 'fdasrs', '15': 'surechembl', '17': 'pharmgkb', '18': 'hmdb', '20': 'selleck', '21': 'pubchem_tpharma', '22': 'pubc...(truncated) | 40 | {'size': -1} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.uniprot._all_uniprots | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.06 | set | {'E2D5N5', 'S4T6J4', 'A0A5C2GBD2', 'Q86VN6', 'A0A678ZXE9', 'A0A2D3BHS4', 'A8K0R1', 'Q8IVZ3', 'A0A087WZZ3', 'G1EPV2', 'A8K0L6', 'Q59FH1', 'H7C0Q9', 'K7EQC9', 'H9U923', 'H0YA31', 'F0UWG7', 'R9Y628', 'Q6IE38', 'Q6QQE4', 'Q9Y2U8', 'B5LZ18', 'A0A7T3RIT3', 'I6M558', 'A0A5C2GGN4', 'A0A5C2G3S0', 'F5GZW1', '...(truncated) | 204,185 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.uniprot._cleanup | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.00 | NoneType | None | 0 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.uniprot._protein_datasheet |
Not calling `pypath.inputs.uniprot._protein_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot._remove |
Not calling `pypath.inputs.uniprot._remove`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot._swissprot_param |
Not calling `pypath.inputs.uniprot._swissprot_param`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.all_swissprots | 2022-04-09 06:50:09 | 2022-04-09 06:50:09 | 0.00 | set | {'Q9NRR5', 'Q9Y2T1', 'A0A0B4J263', 'Q4UJ75', 'Q6IE38', 'Q93099', 'Q9Y2U8', 'Q9H1R3', 'A4D1B5', 'Q96SN8', 'Q9UFB7', 'P63302', 'Q05084', 'Q03060', 'Q9H3V2', 'Q969X1', 'P01860', 'Q86TG1', 'Q96FC7', 'Q96H96', 'Q13425', 'Q9NY35', 'Q9BXM0', 'P11177', 'P18627', 'P55081', 'Q6ZNG9', 'Q96QR8', 'Q76NI1', 'Q8TC...(truncated) | 20,376 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.uniprot.all_trembls | 2022-04-09 06:50:09 | 2022-04-09 06:50:30 | 21.06 | set | {'E2D5N5', 'S4T6J4', 'A0A5C2GBD2', 'Q86VN6', 'A0A678ZXE9', 'A0A2D3BHS4', 'A8K0R1', 'Q8IVZ3', 'A0A087WZZ3', 'G1EPV2', 'A8K0L6', 'Q59FH1', 'H7C0Q9', 'K7EQC9', 'H9U923', 'H0YA31', 'F0UWG7', 'R9Y628', 'Q6QQE4', 'B5LZ18', 'A0A7T3RIT3', 'I6M558', 'A0A5C2GGN4', 'A0A5C2G3S0', 'F5GZW1', 'E9PIS7', 'A0A024R1R7...(truncated) | 183,809 | {} | 2022-04-09 06:50:09 | |
| ¶ | pypath.inputs.uniprot.all_uniprots | 2022-04-09 06:50:30 | 2022-04-09 06:50:30 | 0.00 | set | {'E2D5N5', 'S4T6J4', 'A0A5C2GBD2', 'Q86VN6', 'A0A678ZXE9', 'A0A2D3BHS4', 'A8K0R1', 'Q8IVZ3', 'A0A087WZZ3', 'G1EPV2', 'A8K0L6', 'Q59FH1', 'H7C0Q9', 'K7EQC9', 'H9U923', 'H0YA31', 'F0UWG7', 'R9Y628', 'Q6IE38', 'Q6QQE4', 'Q9Y2U8', 'B5LZ18', 'A0A7T3RIT3', 'I6M558', 'A0A5C2GGN4', 'A0A5C2G3S0', 'F5GZW1', '...(truncated) | 204,185 | {} | 2022-04-09 06:50:30 | |
| ¶ | pypath.inputs.uniprot.deleted_uniprot_genesymbol |
Not calling `pypath.inputs.uniprot.deleted_uniprot_genesymbol`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.get_db | 2022-04-09 06:50:30 | 2022-04-09 06:50:30 | 0.00 | set | {'E2D5N5', 'S4T6J4', 'A0A5C2GBD2', 'Q86VN6', 'A0A678ZXE9', 'A0A2D3BHS4', 'A8K0R1', 'Q8IVZ3', 'A0A087WZZ3', 'G1EPV2', 'A8K0L6', 'Q59FH1', 'H7C0Q9', 'K7EQC9', 'H9U923', 'H0YA31', 'F0UWG7', 'R9Y628', 'Q6IE38', 'Q6QQE4', 'Q9Y2U8', 'B5LZ18', 'A0A7T3RIT3', 'I6M558', 'A0A5C2GGN4', 'A0A5C2G3S0', 'F5GZW1', '...(truncated) | 204,185 | {} | 2022-04-09 06:50:30 | |
| ¶ | pypath.inputs.uniprot.get_uniprot_sec | 2022-04-09 06:50:30 | 2022-04-09 06:50:31 | 0.71 | list | [['A0A023IN41', 'H0Y5F6'], ['A0A024QZ37', 'X5D2H9'], ['A0A024QZ45', 'Q9BX63'], ['A0A024QZA1', 'Q5TDG9'], ['A0A024QZG0', 'O75150'], ['A0A024QZR6', 'Q9UII6'], ['A0A024R056', 'A0A140VJJ8'], ['A0A024R072', 'Q96S94'], ['A0A024R077', 'Q96S94'], ['A0A024R079', 'G3V1E2'], ['A0A024R081', 'J3QRY6'], ['A0A024R...(truncated) | 71,902 | {} | 2022-04-09 06:50:30 | |
| ¶ | pypath.inputs.uniprot.init_db | 2022-04-09 06:50:31 | 2022-04-09 06:50:31 | 0.06 | NoneType | None | 0 | {} | 2022-04-09 06:50:31 | |
| ¶ | pypath.inputs.uniprot.is_swissprot |
Not calling `pypath.inputs.uniprot.is_swissprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.is_trembl |
Not calling `pypath.inputs.uniprot.is_trembl`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.is_uniprot |
Not calling `pypath.inputs.uniprot.is_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.protein_datasheet |
Not calling `pypath.inputs.uniprot.protein_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_data |
Not calling `pypath.inputs.uniprot.uniprot_data`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_families | 2022-04-09 06:50:31 | 2022-04-09 06:50:58 | 26.92 | dict | {'P51451': {UniprotFamily(family='Protein kinase superfamily, Tyr protein kinase', subfamily='SRC')}, 'P09871': {UniprotFamily(family='Peptidase S1', subfamily=None)}, 'Q9ULX7': {UniprotFamily(family='Alpha-carbonic anhydrase', subfamily=None)}, 'Q01518': {UniprotFamily(family='CAP', subfamily=None)...(truncated) | 14,355 | {} | 2022-04-09 06:50:31 | |
| ¶ | pypath.inputs.uniprot.uniprot_history |
Not calling `pypath.inputs.uniprot.uniprot_history`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_history_recent_datasheet |
Not calling `pypath.inputs.uniprot.uniprot_history_recent_datasheet`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_keywords | 2022-04-09 06:50:58 | 2022-04-09 06:51:22 | 24.11 | dict | {'P51451': {UniprotKeyword(keyword='Lipoprotein'), UniprotKeyword(keyword='Diabetes mellitus'), UniprotKeyword(keyword='Membrane'), UniprotKeyword(keyword='Nucleotide-binding'), UniprotKeyword(keyword='Transferase'), UniprotKeyword(keyword='Tyrosine-protein kinase'), UniprotKeyword(keyword='Myristat...(truncated) | 20,376 | {} | 2022-04-09 06:50:58 | |
| ¶ | pypath.inputs.uniprot.uniprot_locations | 2022-04-09 06:51:22 | 2022-04-09 06:51:44 | 22.03 | dict | {'P51451': {UniprotLocation(location='Cell membrane', features=('Lipid-anchor',))}, 'A6H8Y1': {UniprotLocation(location='Nucleus', features=None)}, 'O60885': {UniprotLocation(location='Nucleus', features=None), UniprotLocation(location='Chromosome', features=None)}, 'P22223': {UniprotLocation(locati...(truncated) | 16,856 | {} | 2022-04-09 06:51:22 | |
| ¶ | pypath.inputs.uniprot.uniprot_ncbi_taxids_2 | 2022-04-09 06:51:44 | 2022-04-09 06:51:44 | 0.08 | dict | {648330: Taxon(ncbi_id=648330, latin='Aedes albopictus densovirus (isolate Boublik/1994)', english='AalDNV', latin_synonym=None), 10804: Taxon(ncbi_id=10804, latin='Adeno-associated virus 2', english='AAV-2', latin_synonym=None), 648242: Taxon(ncbi_id=648242, latin='Adeno-associated virus 2 (isolate...(truncated) | 26,873 | {} | 2022-04-09 06:51:44 | |
| ¶ | pypath.inputs.uniprot.uniprot_preprocess |
Not calling `pypath.inputs.uniprot.uniprot_preprocess`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_recent_version |
Not calling `pypath.inputs.uniprot.uniprot_recent_version`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.uniprot.uniprot_taxonomy | 2022-04-09 06:51:44 | 2022-04-09 06:51:53 | 8.19 | dict | {'P00521': {'Abelson murine leukemia virus'}, 'P03333': {'Abelson murine leukemia virus'}, 'H8ZM73': {'Balsam fir', 'Pinus balsamea', 'Abies balsamea'}, 'H8ZM71': {'Balsam fir', 'Pinus balsamea', 'Abies balsamea'}, 'Q9MV51': {'Momi fir', 'Abies firma'}, 'O81086': {'Grand fir', 'Abies grandis', 'Pinu...(truncated) | 552,780 | {} | 2022-04-09 06:51:44 | |
| ¶ | pypath.inputs.uniprot.uniprot_tissues | 2022-04-09 06:51:53 | 2022-04-09 06:52:16 | 23.16 | dict | {'P51451': {UniprotTissue(tissue='Striate ducts of salivary glands', level='undefined'), UniprotTissue(tissue='Leydig cells', level='undefined'), UniprotTissue(tissue='Pancreatic islets', level='undefined'), UniprotTissue(tissue='Lymphatic organs', level='undefined'), UniprotTissue(tissue='Hair foll...(truncated) | 9,938 | {} | 2022-04-09 06:51:53 | |
| ¶ | pypath.inputs.uniprot.uniprot_topology | 2022-04-09 06:52:16 | 2022-04-09 06:53:27 | 71.17 | dict | {'P22223': {UniprotTopology(topology='Transmembrane', start=655, end=677), UniprotTopology(topology='Cytoplasmic', start=678, end=829), UniprotTopology(topology='Extracellular', start=108, end=654)}, 'Q9ULX7': {UniprotTopology(topology='Cytoplasmic', start=312, end=337), UniprotTopology(topology='Tr...(truncated) | 5,217 | {} | 2022-04-09 06:52:16 | |
| ¶ | pypath.inputs.uniprot.valid_uniprot |
Not calling `pypath.inputs.uniprot.valid_uniprot`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.wang.get_hsn | 2022-04-09 06:53:27 | 2022-04-09 06:53:29 | 1.40 | list | [['1909', 'EDNRA', '4683', 'NBN', 'Pos'], ['7040', 'TGFB1', '7040', 'TGFB1', 'Neg'], ['9669', 'EIF5B', '6135', 'RPL11', 'Pos'], ['367', 'AR', '7337', 'UBE3A', 'Phy'], ['5291', 'PIK3CB', '57580', 'PREX1', 'Pos'], ['5568', 'PRKACG', '1499', 'CTNNB1', 'Pos'], ['156', 'ADRBK1', '155', 'ADRB3', 'Pos'], [...(truncated) | 62,937 | {} | 2022-04-09 06:53:27 | |
| ¶ | pypath.inputs.wang.wang_interactions | 2022-04-09 06:53:29 | 2022-04-09 06:53:30 | 1.50 | list | [['EDNRA', 'NBN', '+'], ['TGFB1', 'TGFB1', '-'], ['EIF5B', 'RPL11', '+'], ['AR', 'UBE3A', '0'], ['PIK3CB', 'PREX1', '+'], ['PRKACG', 'CTNNB1', '+'], ['ADRBK1', 'ADRB3', '+'], ['ITGA2B', 'ACTN4', '0'], ['MCM7', 'UBE3A', '-'], ['CD4', 'ITK', '+'], ['STAT3', 'MYC', '+'], ['ZBTB17', 'NDRG2', '-'], ['CSN...(truncated) | 62,937 | {} | 2022-04-09 06:53:29 | |
| ¶ | pypath.inputs.wojtowicz2020._id_translate |
Not calling `pypath.inputs.wojtowicz2020._id_translate`, not enough arguments. |
{} | never | ||||||
| ¶ | pypath.inputs.wojtowicz2020.wojtowicz2020_interactions | 2022-04-09 06:53:30 | 2022-04-09 06:53:32 | 1.51 | list | [Wojtowicz2020Interaction(id_a='P01889', id_b='Q96LC7'), Wojtowicz2020Interaction(id_a='Q8IWK6', id_b='Q96LC7'), Wojtowicz2020Interaction(id_a='Q9BWV1', id_b='P29460'), Wojtowicz2020Interaction(id_a='Q9BWV1', id_b='Q6PI73'), Wojtowicz2020Interaction(id_a='P17213', id_b='Q96A28'), Wojtowicz2020Intera...(truncated) | 483 | {} | 2022-04-09 06:53:30 | |
| ¶ | pypath.inputs.wojtowicz2020.wojtowicz2020_raw | 2022-04-09 06:53:32 | 2022-04-09 06:53:32 | 0.07 | list | [Wojtowicz2020RawRecord(prey_uniprot_name='1B35', bait_uniprot_name='SIG10', prey_common_name='HLA-B', bait_common_name='Siglec-10', prey_gene_name='HLA-B', bait_gene_name='SIGLEC10', prey_bait_replicate1_od650=0.1343, prey_bait_replicate2_od650=0.1416, prey_bait_replicate3_od650=0.1386, prey_contro...(truncated) | 495 | {} | 2022-04-09 06:53:32 | |
| ¶ | pypath.inputs.zhong2015.zhong2015_annotations | 2022-04-09 06:53:32 | 2022-04-09 06:53:32 | 0.21 | dict | {'P12830': {Zhong2015Annotation(type='iCAM')}, 'Q9Y6N8': {Zhong2015Annotation(type='iCAM')}, 'P55287': {Zhong2015Annotation(type='iCAM')}, 'P55290': {Zhong2015Annotation(type='iCAM')}, 'P55291': {Zhong2015Annotation(type='iCAM')}, 'O75309': {Zhong2015Annotation(type='iCAM')}, 'Q12864': {Zhong2015Ann...(truncated) | 466 | {} | 2022-04-09 06:53:32 |
The OmniPath Team • Saez Lab • 2022-04-09